Busch Lab

ZMP

SH3GL2 (1 of 2)

Ensembl ID:
ENSDARG00000039901
Description:
SH3-domain GRB2-like 2 [Source:HGNC Symbol;Acc:10831]
Human Orthologue:
SH3GL2
Human Description:
SH3-domain GRB2-like 2 [Source:HGNC Symbol;Acc:10831]
Mouse Orthologue:
Sh3gl2
Mouse Description:
SH3-domain GRB2-like 2 Gene [Source:MGI Symbol;Acc:MGI:700009]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30009
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067630 Nonsense 176 236 5 5
Genomic Location (Zv9):
Chromosome 23 (position 45062155)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 45330381
GRCz11 23 45043701
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTGTGTGTGTGTGTGTGTGTGTGTCTCTGTCTCTCAGCGCCGCTGGAT[C/T]AGCCGTGTTGTCGCGCGCTCTACGACTTCGAGCCGGAGAACGAGGGCGAG
Associated Phenotype:
Not determined