Busch Lab

ZMP

LOC100333037

Ensembl ID:
ENSDARG00000039884
Human Orthologue:
IL16
Human Description:
interleukin 16 (lymphocyte chemoattractant factor) [Source:HGNC Symbol;Acc:5980]
Mouse Orthologue:
Il16
Mouse Description:
interleukin 16 Gene [Source:MGI Symbol;Acc:MGI:1270855]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20867 Nonsense Available for shipment Available now
sa11532 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20867
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058342 Nonsense 249 1521 6 22
Genomic Location (Zv9):
Chromosome 7 (position 12330296)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 11215852
GRCz11 7 11512662
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGTGTATTTTTGCAGATGCCAATTATAAAGGTGTCAGACGATGATGTC[A/T]AAGACATTGACAATGAAGACCAGGGCTGCCAAGAAATGTCCTGCAAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11532
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058342 Essential Splice Site 769 1521 15 22
Genomic Location (Zv9):
Chromosome 7 (position 12357615)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 11243171
GRCz11 7 11539981
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCACCAGTTAAGGAGGAAGATTTGATGCTCTCACAAAGCAATTGCCAGG[T/C]ATGGMCNNATATWTACTCKATGAAATGATCAATTATGAAGTTTATGTCTTTK
Associated Phenotype:
Not determined