Busch Lab

ZMP

si:dkey-120e24.3

Ensembl ID:
ENSDARG00000039863
ZFIN IDs:
ZDB-GENE-080107-2, ZDB-GENE-091204-247
Description:
leukemia inhibitory factor receptor alpha b [Source:RefSeq peptide;Acc:NP_001107204]
Human Orthologue:
LIFR
Human Description:
leukemia inhibitory factor receptor alpha [Source:HGNC Symbol;Acc:6597]
Mouse Orthologue:
Lifr
Mouse Description:
leukemia inhibitory factor receptor Gene [Source:MGI Symbol;Acc:MGI:96788]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa17514 Nonsense Available for shipment Available now
sa6671 Nonsense Mutation detected in F1 DNA Not yet available
sa29572 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17514
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058306 Nonsense 19 960 1 17
ENSDART00000131890 Nonsense 19 951 2 18
Genomic Location (Zv9):
Chromosome 21 (position 20076426)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21211915
GRCz11 21 21248551
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGTCTGGCTATTGAGTGCTTTGCTTGTGTCTCTGATTGAGCTGGYAGAA[C/T]AGGATGGTGAGTCTTAGATGCATTTAATCAAAAATCATCACCACGAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6671
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058306 Nonsense 322 960 7 17
ENSDART00000131890 Nonsense 322 951 8 18
Genomic Location (Zv9):
Chromosome 21 (position 20080594)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21216083
GRCz11 21 21252719
KASP Assay ID:
554-4930.1 (used for ordering genotyping assays)
KASP Sequence:
ACCTCATAATATATCCCATGCTGCTCATGCAAGAAATGCCACTGTTCACT[G/A]GAGTTGGAGTGTAACAGAATATGCTTCACTTCTAATGATTTGCCAAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29572
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058306 Nonsense 407 960 9 17
ENSDART00000131890 Nonsense 398 951 10 18
Genomic Location (Zv9):
Chromosome 21 (position 20082420)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21217909
GRCz11 21 21254545
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTAATAATTTCTCTTCAGTTCCAGAACTGGTAGATGTTTGGATTCAATA[T/G]TCTGAAAACCACACATATATTCAATGGAAGGTACGTGCAATTTTGTATCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29573
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058306 Essential Splice Site 585 960 12 17
ENSDART00000131890 Essential Splice Site 576 951 13 18
Genomic Location (Zv9):
Chromosome 21 (position 20083303)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21218792
GRCz11 21 21255428
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGCACCAGTGCTTCTGCAGAGGAGTGAGGGATACGCTATAGAGCAAGG[T/C]AAGGAGTCAAATCTAAATCTTTTTAAGTACTATAGTTAGTAAAGGTCATG
Associated Phenotype:
Not determined