Busch Lab

ZMP

A0JMB2_DANRE

Ensembl ID:
ENSDARG00000039778
Description:
Zgc:152720 [Source:UniProtKB/TrEMBL;Acc:A0JMB2]
Human Orthologue:
NEDD4
Human Description:
neural precursor cell expressed, developmentally down-regulated 4 [Source:HGNC Symbol;Acc:7727]
Mouse Orthologue:
Nedd4
Mouse Description:
neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa16624 Nonsense Available for shipment Available now
sa35609 Nonsense Mutation detected in F1 DNA Not yet available
sa22392 Nonsense Available for shipment Available now
sa7381 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16624
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058161 Nonsense 207 787 9 25
Genomic Location (Zv9):
Chromosome 13 (position 52174742)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 688337
GRCz11 18 577555
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTGCCTGCRCTGCCCCCTGGCTGGGAGGAGAGGCAGGACAACCTGGGA[C/T]GAACTTACTACGTCAACCACGAGAGCAGGACCACACAGTGGCACAGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35609
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058161 Nonsense 417 787 14 25
Genomic Location (Zv9):
Chromosome 13 (position 52182160)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 695755
GRCz11 18 584973
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTTTCCCAGAATGCCGCAGGCTACGCTCTGCCCCCAGACGTGTCCCCA[C/T]AGCACACACACACTCACACACACACTCACACGCCGGAGCACCCAGGACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22392
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058161 Nonsense 554 787 19 25
Genomic Location (Zv9):
Chromosome 13 (position 52188809)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 702404
GRCz11 18 591622
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCAAAAGCCTCTGTTGTGTGTCTGCAGGCAGAGATCCCGAATCGCTTC[G/T]AGCTGAGTGTGCGGCGTAACGCAGTGCTGGAGGACTCATACAGACGCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7381
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058161 Missense 760 787 24 25
Genomic Location (Zv9):
Chromosome 13 (position 52199184)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 712779
GRCz11 18 601997
KASP Assay ID:
554-4264.1 (used for ordering genotyping assays)
KASP Sequence:
CAGTCTGGTGATGCAGTGGAGGTTTGTGGATCGCATACAAAGACAGATGA[C/T]GGCCTTTAAGGAGGTAAAGACAMMCATTCWGCCATTYGGGTCACTGTTRA
Associated Phenotype:
Not determined