Busch Lab

ZMP

dync2li1

Ensembl ID:
ENSDARG00000039770
ZFIN ID:
ZDB-GENE-040426-1230
Description:
Cytoplasmic dynein 2 light intermediate chain 1 [Source:UniProtKB/Swiss-Prot;Acc:Q7SXY4]
Human Orthologue:
DYNC2LI1
Human Description:
dynein, cytoplasmic 2, light intermediate chain 1 [Source:HGNC Symbol;Acc:24595]
Mouse Orthologue:
Dync2li1
Mouse Description:
dynein cytoplasmic 2 light intermediate chain 1 Gene [Source:MGI Symbol;Acc:MGI:1913996]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa22241 Nonsense Available for shipment Available now
sa35430 Nonsense Available for shipment Available now
sa31909 Essential Splice Site Available for shipment Available now
sa6287 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42151 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28073
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058147 Essential Splice Site 85 358 4 13
Genomic Location (Zv9):
Chromosome 13 (position 10537023)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10839352
GRCz11 13 10971827
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTTGCACTGGAGTACACTTTTGGAAGGCGTGCAAGAGGTCATAATACGG[T/G]AAAAGTGACAGTCCTGTCATCAGTTTATATATTTATTCTCCATTCATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22241
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058147 Nonsense 141 358 6 13
Genomic Location (Zv9):
Chromosome 13 (position 10538941)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10841270
GRCz11 13 10973745
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTCTAAACCCAATGCGCTCTGGGAGACCATGGAAAGTCTGCTAGGAT[C/A]AGCTCGAAATCAGGTGGAAAAAGTGTGTGCCGCGCTGCAGAAGACAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35430
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058147 Nonsense 168 358 6 13
Genomic Location (Zv9):
Chromosome 13 (position 10539021)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10841350
GRCz11 13 10973825
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGCGCTGCAGAAGACAGGAGAATCCAGATCTGGCAAACAACGAGTCCCA[C/T]GAGTCCTCCACAAGGACTATCCGGTACAGAGGATTACACCATTTCTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31909
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058147 Essential Splice Site 198 358 7 13
Genomic Location (Zv9):
Chromosome 13 (position 10539194)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10841523
GRCz11 13 10973998
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTCCCTGTTCCTCTGCTCATAGTTGGGAGCAAGTTTGACATTTTTCAG[G/A]TAAAACTTCACTGACATGTTCATAGTAGTATGTACAGTGTGGTGATGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6287
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058147 Essential Splice Site 275 358 10 13
Genomic Location (Zv9):
Chromosome 13 (position 10541639)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10843968
GRCz11 13 10976443
KASP Assay ID:
554-4771.1 (used for ordering genotyping assays)
KASP Sequence:
AGTAAACCTCTGGCTAKTCCAGCAGGATCAGACTCYCTRAGTCAAATCGG[T/A]AAGATACGTATKTTTTTGTTAAAGACAAACTAACTTTTATGCTTTTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42151
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058147 Essential Splice Site 308 358 12 13
Genomic Location (Zv9):
Chromosome 13 (position 10543867)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10846196
GRCz11 13 10978671
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGACAACCTTATAATAAATGTTCATCTGACCCTCCTATTTATTTTTTC[A/T]GAGCACAAGGGAGCGTAAAGAGCTGAAAGACCCTGTCAAAGACCCTCAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3860
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058147 Essential Splice Site 338 358 12 13
Genomic Location (Zv9):
Chromosome 13 (position 10543963)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10846292
GRCz11 13 10978767
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGTTCAGCGAGCCGCTTATAGACTCTATCAGAGCACAGAAAGACCAGG[T/C]ACGAGACACATTTACAGTCTGTCTTCACATTATTTGACTTCTAGTAACCT
Associated Phenotype:
Not determined