Busch Lab

ZMP

asap1

Ensembl ID:
ENSDARG00000039729
ZFIN ID:
ZDB-GENE-091112-16
Human Orthologue:
ASAP1
Human Description:
ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 [Source:HGNC Symbol;Acc:2720]
Mouse Orthologue:
Asap1
Mouse Description:
ArfGAP with SH# domain, ankyrin repeat and PH domain1 Gene [Source:MGI Symbol;Acc:MGI:1342335]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa30052 Nonsense Mutation detected in F1 DNA Not yet available
sa24454 Essential Splice Site Available for shipment Available now
sa1723 Nonsense Confirmed mutation in F2 line Not yet available

Mutation Details

Allele Name:
sa30052
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030409 Nonsense 124 1156 4 30
ENSDART00000131204 None None 350 None 8
ENSDART00000144372 None None 223 None 4
ENSDART00000145466 Nonsense 123 1140 4 29

The following transcripts of ENSDARG00000039729 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 10743385)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 10830788
GRCz11 24 10971155
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTCGGGATAATCCAGATCTGGGCACAGCCTTTGTTAAATTCTCCACTT[T/A]GACTAAAGAGCTTTCTGCCCTCCTCAAGAACCTGGTGAGTCCTCTATGCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30051
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030409 Nonsense 252 1156 9 30
ENSDART00000131204 None None 350 None 8
ENSDART00000144372 None None 223 None 4
ENSDART00000145466 Nonsense 251 1140 9 29

The following transcripts of ENSDARG00000039729 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 10722327)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 10809730
GRCz11 24 10950097
KASP Assay ID:
2261-8483.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGTCTATTGCCTAATTATTATATGTATTTTTTTTCATTCAGCTTTTTC[C/T]AAGATGGCTTGAAGACGGCAGATAAACTGAAGCAGTACATTGAGAAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24454
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030409 Essential Splice Site 337 1156 11 30
ENSDART00000131204 None None 350 None 8
ENSDART00000144372 None None 223 None 4
ENSDART00000145466 Essential Splice Site 336 1140 11 29

The following transcripts of ENSDARG00000039729 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 10719765)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 10807168
GRCz11 24 10947535
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGAGTTTGGCTGTGAGAAGAAAGGCTATCTGTTAAAGAAGAGTGATGG[G/A]TACACGCATATACACACACTCAATTTTACATGTGGTTTCTGATCGTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1723
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030409 Nonsense 991 1156 28 30
ENSDART00000131204 Nonsense 314 350 8 8
ENSDART00000144372 Nonsense 190 223 4 4
ENSDART00000145466 Nonsense 975 1140 27 29

The following transcripts of ENSDARG00000039729 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 10679627)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 10767030
GRCz11 24 10907397
KASP Assay ID:
554-1669.1 (used for ordering genotyping assays)
KASP Sequence:
CACAGCCTTCAGAATTACCACCTAAACCAGGAGAACTGCCTCCAAAGCCT[C/T]AACTGTCCGAACTTCCCCCTAAACCCCAGTTGGGTGACCTACCACCTAAA
Associated Phenotype:
Not determined