Busch Lab

ZMP

ENSDARG00000039716

Ensembl ID:
ENSDARG00000039716

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38202 Nonsense Mutation detected in F1 DNA Not yet available
sa30469 Nonsense Mutation detected in F1 DNA Not yet available
sa38201 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38202
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058053 Nonsense 244 710 1 2
Genomic Location (Zv9):
Chromosome Zv9_NA629 (position 19389)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACTGGAGAGAAACCTTACAAGTGTTCACACTGCGACAAGAGATTCAGA[C/T]AGTCATCACAATTGAAAATACATGAGAGGATTCACACTGGAGAGAAACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30469
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058053 Nonsense 247 710 1 2
Genomic Location (Zv9):
Chromosome Zv9_NA629 (position 19380)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAAACCTTACAAGTGTTCACACTGCGACAAGAGATTCAGACAGTCATCA[C/T]AATTGAAAATACATGAGAGGATTCACACTGGAGAGAAACCGTACAAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38201
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058053 Nonsense 318 710 2 2
Genomic Location (Zv9):
Chromosome Zv9_NA629 (position 7645)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGAAAATCATAGAAAATACACACTCACTGAAGAGAAAAGGCAAAAAATG[C/A]TTCACCTGCACTCAGTGTGGAATAAGTCTAGCAACCAAACAAACTCTCAG
Associated Phenotype:
Not determined