Busch Lab

ZMP

SHOT1_DANRE

Ensembl ID:
ENSDARG00000039697
Description:
Shootin-1 [Source:UniProtKB/Swiss-Prot;Acc:Q6P0R8]
Human Orthologue:
KIAA1598
Human Description:
KIAA1598 [Source:HGNC Symbol;Acc:29319]
Mouse Orthologue:
4930506M07Rik
Mouse Description:
RIKEN cDNA 4930506M07 gene Gene [Source:MGI Symbol;Acc:MGI:1918903]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa9054 Nonsense Mutation detected in F1 DNA Not yet available
sa42914 Nonsense Mutation detected in F1 DNA Not yet available
sa44871 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42913 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9054
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058027 Nonsense 86 544 4 17
ENSDART00000130377 Nonsense 124 582 5 18
Genomic Location (Zv9):
Chromosome 17 (position 21184468)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21334617
GRCz11 17 21354453
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGGAGAATTTAGAGATCGAGAAGACATGCAGAGAGAGCGTGGAGGCTT[T/A]GGCCTCAAAGGTGAGGGTTACTTTCTGTTTGTTTCCTTTGATTCTCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42914
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058027 Nonsense 278 544 9 17
ENSDART00000130377 Nonsense 316 582 10 18
Genomic Location (Zv9):
Chromosome 17 (position 21167793)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21317942
GRCz11 17 21337778
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAGAAAGCTCTGGCAGAAATCAGCACACTGACACACACTCTGGAGAAA[C/T]AGAGACTGGAGCATCAGCAACAGGTCACACACACACATTAATTCCCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44871
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058027 Essential Splice Site 337 544 10 17
ENSDART00000130377 Essential Splice Site 375 582 11 18
Genomic Location (Zv9):
Chromosome 17 (position 21164709)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21314858
GRCz11 17 21334694
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAAACACACTAAAGCTGAAACCGAAGCCAAAGACCTCAGATTCACAGG[T/C]ACCAGGGTTTAACATCTGAAAGCCATTTTGAAGTCAGGTTGACATCATAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4708
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058027 Nonsense 345 544 11 17
ENSDART00000130377 Nonsense 383 582 12 18
Genomic Location (Zv9):
Chromosome 17 (position 21164515)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21314664
GRCz11 17 21334500
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAACAGCTTTGTTTGTTTKTTTGCAGTGGAGGAACTGAAAAARAAGCTC[C/T]AGCAGGTCTCCAAYCCTCCAACTGCTGCCCCAGCACCWCCTCCTCCTCCM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42913
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058027 Nonsense 388 544 12 17
ENSDART00000130377 Nonsense 426 582 13 18
Genomic Location (Zv9):
Chromosome 17 (position 21161796)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 21311945
GRCz11 17 21331781
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTCTTGTCTTTTATCTCTTACAGCTCATTGCTATCAATACTTCGTAAG[A/T]AAAAAGATGTGAGCACTGAAATCGCATTAGTGGAAAAAGACTCCTCTGAG
Associated Phenotype:
Not determined