Busch Lab

ZMP

alg14

Ensembl ID:
ENSDARG00000039671
ZFIN ID:
ZDB-GENE-041010-195
Description:
UDP-N-acetylglucosamine transferase subunit ALG14 homolog [Source:RefSeq peptide;Acc:NP_001006092]
Human Orthologue:
ALG14
Human Description:
asparagine-linked glycosylation 14 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:28287]
Mouse Orthologue:
Alg14
Mouse Description:
asparagine-linked glycosylation 14 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914039]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8042
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057999 Nonsense 201 219 4 4

The following transcripts of ENSDARG00000039671 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 31343524)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 31264080
GRCz11 24 31201291
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCTCTGTCCGGGAAGATGCTCTACTACATTTCTGACTACTTCTTTGTG[C/T]AGTGGGCACAGCTCAAAGACAAATACCCAAATGCCATCTACATGGGAAGA
Associated Phenotype:
Not determined