Busch Lab

ZMP

im:7152917

Ensembl ID:
ENSDARG00000039661
ZFIN ID:
ZDB-GENE-050309-239
Human Orthologue:
SLC36A4
Human Description:
solute carrier family 36 (proton/amino acid symporter), member 4 [Source:HGNC Symbol;Acc:19660]
Mouse Orthologue:
Slc36a4
Mouse Description:
solute carrier family 36 (proton/amino acid symporter), member 4 Gene [Source:MGI Symbol;Acc:MGI:244

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa39066 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35979 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39066
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057972 Essential Splice Site 74 488 3 11
Genomic Location (Zv9):
Chromosome 15 (position 39753001)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41269708
GRCz11 15 41227104
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACAGGATTGCTCGGGCTTCCTCTAGCAGTGAAGAATGCTGGCATAGTG[G/A]TATGTATTAATAAACTAGGTCAAGGTTAACATCAGCATTTTCAATTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35979
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057972 Essential Splice Site 104 488 4 11
Genomic Location (Zv9):
Chromosome 15 (position 39750373)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41267080
GRCz11 15 41224476
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCACTGCATGCACATCCTGGTCAACTGCAGCCATCAGCTGAGTGAGCGG[T/A]AAGAATACACCAATCAAAGCCCTCCGCCTCAGTCTGCACAGCCAGTCACA
Associated Phenotype:
Not determined