Busch Lab

ZMP

zgc:103663

Ensembl ID:
ENSDARG00000039647
ZFIN IDs:
ZDB-GENE-041114-57, ZDB-GENE-041114-57
Description:
sodium- and chloride-dependent GABA transporter 1 [Source:RefSeq peptide;Acc:NP_001007363]
Human Orthologue:
SLC6A1
Human Description:
solute carrier family 6 (neurotransmitter transporter, GABA), member 1 [Source:HGNC Symbol;Acc:11042
Mouse Orthologue:
Slc6a1
Mouse Description:
solute carrier family 6 (neurotransmitter transporter, GABA), member 1 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa27704 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41754 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3799
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017551 Nonsense 71 600 1 14
ENSDART00000057952 Nonsense 71 600 2 15
Genomic Location (Zv9):
Chromosome 11 (position 1010269)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 996532
GRCz11 11 1023120
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTGTGTTGGCTACGCCATTGGACTCKGCAATGTCTGGAGATTTCCTTA[T/A]CTATGCGGGAAAAACGGAGGAGGTAAATGTATTTTCCAGCTTCGAAAGAA
Long Flanking Sequence:
TTTTTTAAAAATAAATGAATAAATAAATGCGTGCGCGCACCAATCGCAGGTGCGCAATTTGTATTTTAACTCGCGTCTTATTTTATTTTTGTATACTGTTCGTGCAGAAACAGCTATAACCAATGCACATATCTAAACCAGCCCTCCCTCTCCTTCATTTCCAGGTCACTGTCAAGCATCATCGGCGTTTTTTGGTTCTAGTCGTGGGTTTAACGAACCGCGAAGCTGCTGTCTACGTGGACCGGTGCTGAACTCTCCCGTCCGACCGCCAGGACCAAACCCCGAGACATGGCCACGAACGGCACCAAAGCCTCCGATGGACACGTTTTAACAGAAGTGAACGAAGCGCCCACCGCCAACGACAAACCAAAAACTCTGGTGGTCAAAGTTCAGAAGAAGAAGGAACTTCCCGACAGGGAAACATGGCAGGGAAAATTTGACTTTCTTCTGTCTTGTGTTGGCTACGCCATTGGACTCGGCAATGTCTGGAGATTTCCTTA[T/A]CTATGCGGGAAAAACGGAGGAGGTAAATGTATTTTCCAGCTTCGAAAGAAAAGGAGTAAAAATCATTGGAAGCGCAGAGACGGATTATATTTCAATGTGTCTGATTGTGTTGCTCTTCTGTCTGTATAGGGGCCTTCTTGATTCCTTACTTTTTGACCCTTATATTTGCTGGGGTCCCGTTGTTTTTTCTGGAAACGGCCCTCGGCCAGTACACGTCCATTGGTGGGCTTGGAGTGTGGAAACTTGCTCCTATGTTCAAAGGTAACCAACATATGGAGCATCAATAACCTCAGATCAATGATTGCACTCATTACGCACGCACGCTATTTTCTGTGAATGCGCGAGAATATTCCTCCGCGAGTGTCGAGATCATAACAAATATTAACGCTGTGTTAACGAGCACAAGATGATATGAAGTAACAATTTAATGATGTGGCAGAAATATGACGATTCATAAAAAGATGACACCGGAAGTCTCGCGCATTCAAATTATAAATAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27704
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017551 Essential Splice Site 474 600 11 14
ENSDART00000057952 Essential Splice Site 474 600 12 15
Genomic Location (Zv9):
Chromosome 11 (position 998393)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 984656
GRCz11 11 1011244
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCTGTTCCTCGTCTTCTTTGAGTGCGTCTCCATATCCTGGTTCTACG[G/T]TAAATGTCCTTAAATAAAATAACTATTTAATTAATTTGAATGCAGATTAT
Long Flanking Sequence:
TTTAAATACATGACAAATATATAAATAAATAATAAATAAATAATCTCTTTCCCACATTTTGCGGAATGTCATATCATAGATGTTTCATTCAGAAAGATGGGGAAAAGGGTTTGGGGAGAGTTATTACAACCTAACAGACTCCTCCTCCTCACCATTTCTGTTTGATGTTAAAGGGGGGTGTGGTTATGTATGTTAGCCACACCCATTACCTCAGACATACCAAATTTGCAGATTTACATTAAAGATTACTAGAGCAAACTATTGTTTTGTTCTTAATGACATGCACAGATAAATTGTTCAGCATAAAACTAGCAATGTGAGCTAAATCAAAATAAGGATCAATATGGTGAGTTTTGAATTCATCTGTACTTTAATCGTGTTTATCTTGTGTGGACAGGGCGGTCTGTATGTGTTCAAACTCTTCGACTATTACTCTGCCAGCGGGATGTGTCTGCTGTTCCTCGTCTTCTTTGAGTGCGTCTCCATATCCTGGTTCTACG[G/T]TAAATGTCCTTAAATAAAATAACTATTTAATTAATTTGAATGCAGATTATGCAATTACATATGTGTCATGCAAATTTCTATATGGATTTCACATATTGTTAGATAATTAAAAAGTGGTAGTTTAGTTTTTTTTTCAACTATTGGAATTACAAAAATGCACATATATAAAAATATGGCTAATATATTTGAACATGTGTGTTTTTATTTACGACCATATGAATGTGCCAAAAGTTTTGAAAATGCCTTTTGTATGCAGATGGTGAATTTTCTTACAAGTATTCTGTTAAATGACCATATGTGCAAATTACATACAGTATATGACAGACAAGTTTATATTTATATATCACATGTACAACAAATATATTTTTAATTATTGCAAAAATGATAGTGTAGATTTTTTTTAAACCATTGAAATTGAAAATATGCACATATGTTCACATATATTAGCTCTAATTTCATATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41754
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017551 Nonsense 496 600 12 14
ENSDART00000057952 Nonsense 496 600 13 15
Genomic Location (Zv9):
Chromosome 11 (position 995454)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 981717
GRCz11 11 1008305
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTATGGCAACCTGGAGGAGATGATCGGATACAAGCCGTGCATTTGGTGG[A/T]AGCTGTGCTGGGTGGTGTTCACTCCGCTGATCGTGGCGGTAGGTGCATTT
Long Flanking Sequence:
AGTGCTTTTTTCAGCTCAAACTGAAACACGTGCACTGTAGAGACACTAATTTTACATCTTAGGTTAAATAGGTCCCCTTTAAATCCACATGGTGAAGAATATAGACGTAATCATTTTTATTTTTGTGTGAACTGTCCCTTTAATAATTTGTTTGCATTAATTTCCGCTCACAAGCAGGCATAATGCGTAACGCATGCTAATGATTATCAGAGATCTTCATAATTCATGCTAATCTCGGTGCCAGACTCATTTCCACACTCAGATGATTTGACTGAATGTGAACCTGCAGAATCTTAATTGTTGTGCGTGGCAGGCCTGATTATGCAAACGACTGGGCGATCCTCCATTTGCATTTATGAAGAGGCTTCACAGACCTCCAGCCGGCTGTAATACACACGCAGTACTGCATTGACACTCTTTATATTTGTGTTTTTGCAGGTGTCAATAAATTCTATGGCAACCTGGAGGAGATGATCGGATACAAGCCGTGCATTTGGTGG[A/T]AGCTGTGCTGGGTGGTGTTCACTCCGCTGATCGTGGCGGTAGGTGCATTTATTGCGTGTTTTTTTTAAATATTTAACAAAAACAATGTGCATACAGTAGGTTTCACAATAAACATGAGTAAACGAAACAAAAGCACAAACTGCACTGCTTGTCTTATTTTTAATAGTGGTGTACGTTGCAAAGAACTTCATATACACTGCAAAAAAATGCTTTTCTTACATTTTTTTTTCTTATTTCTAATCCAAATGTCTAGAAATTCTTGAATTAAGAAGAATTTTCTAGACAAGCAAAACATATTGTCTTGTTTTAATAAATAATATGCCAAATTGAAGTTAGTTTTTCCTTAAAACAAGCAAAATAATCTTATGTCAACAGAAAAACAAGACTATATTTCTTACCCCATTTGCAGATTATTTTGCTTGTTTTAAGGAAAAACTGAATGAACATTGGCATATTGTTTATAAAAAAAATGTAAGAACTTTTCGATATATCTTGGACTA
Associated Phenotype:
Not determined