Busch Lab

ZMP

si:dkey-179o14.3

Ensembl ID:
ENSDARG00000039616
ZFIN ID:
ZDB-GENE-090313-204
Description:
Novel protein similar to H.sapiens CENPK, centromere protein K (CENPK) [Source:UniProtKB/TrEMBL;Acc:
Human Orthologue:
CENPK
Human Description:
centromere protein K [Source:HGNC Symbol;Acc:29479]
Mouse Orthologue:
Cenpk
Mouse Description:
centromere protein K Gene [Source:MGI Symbol;Acc:MGI:1926210]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa25607 Nonsense Mutation detected in F1 DNA Not yet available
sa32700 Nonsense Mutation detected in F1 DNA Not yet available
sa19520 Nonsense Available for shipment Available now
sa7369 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25607
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057886 Nonsense 10 306 2 11
ENSDART00000139828 None None 169 1 9
ENSDART00000146567 None None 275 1 10

The following transcripts of ENSDARG00000039616 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 30970052)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30783512
GRCz11 1 31516080
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGGCGTATTACATCAGCATTACGTCAATACGTCGCGTTGGCTGGCGGTA[T/G]TTTTGTTTTGAATGTACGCTGTTTGATCTGAAGCTGTGGTCAAGCATTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32700
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057886 Nonsense 28 306 2 11
ENSDART00000139828 None None 169 1 9
ENSDART00000146567 None None 275 1 10

The following transcripts of ENSDARG00000039616 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 30969999)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30783459
GRCz11 1 31516027
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTGAATGTACGCTGTTTGATCTGAAGCTGTGGTCAAGCATTAGCT[T/G]AAATATAAGTATGGTGAGTACTAGTACGACTAGCTAAACGCTGTTTACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19520
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057886 Nonsense 63 306 3 11
ENSDART00000139828 Nonsense 32 169 2 9
ENSDART00000146567 Nonsense 32 275 2 10

The following transcripts of ENSDARG00000039616 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 30969627)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30783087
GRCz11 1 31515655
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGACTTCAGAGGACACAGGCTGTATGAGTGCTGCAAAAGCTGTGTTGT[T/A]GGATGAGTGTGAGGAGCAGTTCGGGCTGCTACAGAAGGTAATTTGACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7369
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057886 Missense 221 306 9 11
ENSDART00000139828 None None 169 9 9
ENSDART00000146567 Missense 190 275 8 10

The following transcripts of ENSDARG00000039616 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 30963547)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 30777007
GRCz11 1 31509575
KASP Assay ID:
554-4197.1 (used for ordering genotyping assays)
KASP Sequence:
GAATATCATAGCAGCCTCATGGAAATGCTGAGYGACATGTTAGCTGAGCA[C/A]TTCCCACTTCCTGATCCTCAAGAAARCGGCAGTAAGAAAAAAAGAGTAAG
Associated Phenotype:
Not determined