Busch Lab

ZMP

zgc:112433

Ensembl ID:
ENSDARG00000039608
ZFIN ID:
ZDB-GENE-050417-294
Description:
hypothetical protein LOC550469 [Source:RefSeq peptide;Acc:NP_001017772]
Human Orthologue:
FUT9
Human Description:
fucosyltransferase 9 (alpha (1,3) fucosyltransferase) [Source:HGNC Symbol;Acc:4020]
Mouse Orthologue:
Fut9
Mouse Description:
fucosyltransferase 9 Gene [Source:MGI Symbol;Acc:MGI:1330859]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa45308 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5462
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057872 Nonsense 161 354 2 2
Genomic Location (Zv9):
Chromosome 8 (position 3632029)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3347823
GRCz11 8 3406572
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTACAGACATGACGCTGATATTCTTGTACGGTGGCGTGTGAGAACCAGG[A/T]AGAAACCAGAGGAGGATTTCGTCRTTCCAAAAAAGGACAAACTGGTTTGT
Long Flanking Sequence:
TGCCTCGCCTGGTTGCTATAATGGTAGTGGCAGGACTAGTCTCTTTGACGATCCTCTATTGCTGGTCCTCAACTCCAAATAACTGTCCAGCTCCACTACCTAACCCGAAGCAACAAGAAAGTTACTCTGCCAAGAAAAGTGACTCTCTGACTGGTACAGCAGAAGACAAACCTATCCTTCTGTTGTGGTTCTGGCCTGAAAACTACTTCTTTGATTTCAGTGACTGCAAAACCATTTTCAATATTGATGGTTGTCATTTGACGGATAATAGATCACTCTATGACACATCAGACGCAGTCCTCATTTTTCACAAAGCCATCAGCTGGGATCTGACCAACCTTCCTCAATCGCCTCGTCCTCGGTTCCAGAGGTGGATTTGGTTTCATGTTGAATCACCAACCAACACCAGAAAGATTCCTGGTCTGGAAAACCTCTTCAATCTCACTCTCAGCTACAGACATGACGCTGATATTCTTGTACGGTGGCGTGTGAGAACCAGG[A/T]AGAAACCAGAGGAGGATTTCGTCGTTCCAAAAAAGGACAAACTGGTTTGTTGGATTGTAAGTAACAATGCTGCATCGACTGGTGTCGGCACAAGAAACAAGTTTTATGAAGAGTTCAGCAAACACATCCAAGTTACTATGTTTGGAAAGGCTTATGCAAATTTTTTGGATTTTAATGAGTACTATCCTACCCTCGCTAGCTGCAAATTTTACCTCTCCTTTGAGAACTCCATCCACAAGGACTATTTTACAGAGAAGATCAATGGTCCTCTTGCTGTAGGAACTGTTCCTGTGGTTTTGGGTCCTCCAAGAAAGAACTATGAAAACTTTGTTCCTGGAGACTCCTTTATTCATGTGGAGGACTTTCCAGATCCAAAGTCACTGGCAGAATATCTGCTTCAGCTGGATAAAGATGACGGTGCCTATCGCAGGTACTTTAACTGGAGGAAACATCTCACTGCAACTCCTCATTTAATCCAGCAGACCCAAGAGTTCATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45308
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057872 Nonsense 352 354 2 2
Genomic Location (Zv9):
Chromosome 8 (position 3631454)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3348398
GRCz11 8 3407147
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAGCACGACACAGGGAATATAAAGAAGCTCATGATATCTATGACTGGTA[T/A]TTTAACTAATATAAACAATCTCAGATTTTCTAATTGTGAACATCCATGGA
Long Flanking Sequence:
TCGACTGGTGTCGGCACAAGAAACAAGTTTTATGAAGAGTTCAGCAAACACATCCAAGTTACTATGTTTGGAAAGGCTTATGCAAATTTTTTGGATTTTAATGAGTACTATCCTACCCTCGCTAGCTGCAAATTTTACCTCTCCTTTGAGAACTCCATCCACAAGGACTATTTTACAGAGAAGATCAATGGTCCTCTTGCTGTAGGAACTGTTCCTGTGGTTTTGGGTCCTCCAAGAAAGAACTATGAAAACTTTGTTCCTGGAGACTCCTTTATTCATGTGGAGGACTTTCCAGATCCAAAGTCACTGGCAGAATATCTGCTTCAGCTGGATAAAGATGACGGTGCCTATCGCAGGTACTTTAACTGGAGGAAACATCTCACTGCAACTCCTCATTTAATCCAGCAGACCCAAGAGTTCATTCTGCCCATATGCACTGCCTGTGATTATATAGCACGACACAGGGAATATAAAGAAGCTCATGATATCTATGACTGGTA[T/A]TTTAACTAATATAAACAATCTCAGATTTTCTAATTGTGAACATCCATGGAGGGATTTTGATAATCACTGCAAATGGATAAACTTGATCAAGTGTGTGAAAATGTTTTATAGTGAATGTGAAGTACTTGAGATTTATTAACCAAATGCATCCAAATCATTACCAGGTCAATAACTGCATGAACCCAAATGTTATTATTTTGCCTTTTTCCATTGGAAATAAATGATAGTAAACAAACCATTTTGACACAAATGTACAAATTCTGGGTCATTTAACATTCTGCATAGTTGCTTTATAGTTTGAATAACACAAATCTTTTTTTTTTTTTGCTTATACATTTTTGCTAAAATGGAGCAATAAGGAGTGCTATAATGAGTTAGTCACAATGGGTAGGTTTGGTATTGGGTGCGGTGCACTAATCTTCAAACTGTCTGTCAATGTATTTAGATAGACATACGCAGATACATTGTTTCCAGAACACAATCTTAAAACACACATGCGG
Associated Phenotype:
Not determined