Busch Lab

ZMP

pa2g4a

Ensembl ID:
ENSDARG00000039578
ZFIN ID:
ZDB-GENE-030616-161
Description:
proliferation-associated 2G4, a [Source:RefSeq peptide;Acc:NP_001002070]
Human Orthologue:
PA2G4
Human Description:
proliferation-associated 2G4, 38kDa [Source:HGNC Symbol;Acc:8550]
Mouse Orthologue:
Pa2g4
Mouse Description:
proliferation-associated 2G4 Gene [Source:MGI Symbol;Acc:MGI:894684]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa9349 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9349
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057823 Nonsense 9 392 1 13
Genomic Location (Zv9):
Chromosome 6 (position 7450609)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 7376625
GRCz11 6 7533794
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCCTCTTYCAGAGCCGGTGCAACGATGTCCGACGACGAGCAGCAAGAG[C/T]AGACCATCGCCGAGGACTTGGTCGTGACCAAGTACAAGATGGGCGGTGAC
Associated Phenotype:
Not determined