Busch Lab

ZMP

zgc:153390

Ensembl ID:
ENSDARG00000039543
ZFIN ID:
ZDB-GENE-060825-59
Description:
mitochondrial ribosomal protein S6 [Source:RefSeq peptide;Acc:NP_001038921]
Human Orthologue:
MRPS6
Human Description:
mitochondrial ribosomal protein S6 [Source:HGNC Symbol;Acc:14051]
Mouse Orthologue:
Mrps6
Mouse Description:
mitochondrial ribosomal protein S6 Gene [Source:MGI Symbol;Acc:MGI:2153111]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2692
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057774 Nonsense 4 118 1 2
Genomic Location (Zv9):
Chromosome 13 (position 4672229)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4867007
GRCz11 13 4995593
KASP Assay ID:
554-2860.1 (used for ordering genotyping assays)
KASP Sequence:
TTAGCTTGATATAAACTCTGGCGTTCAAAGCYCCGGAGGATGCCTCGGTA[T/A]GAGCTGTATATGGTCCTGAAGGCGATGCAGAGGCCGGAGACCGCKGCTGT
Long Flanking Sequence:
TTAAACACTAAAAACTGAACTACCCTGATTTAGTTACTATGACCATTTATGTAAAGCTGCTTTGACACAATCTACATTGTAAAAGCGCTATACAAATAAAGCTGAATTGATTTAAAGTTTGGTTACATTGGGTTAGGATTGGCCAGCCCAGTCAACAGACATTAACATTATTGAGCTGAAACAACACAGTTCTTGAGATTTTTTGAGGGGACAACTTGATTGTTTTATGTTCAATCCACTTACATTTTTTTAAGTTAACTCAATCGATTTGTGTTGAGACAACATGAATGTATTGTGTGGAACGCTGCATTTTTTTTTACAGTGACAACCTATTTTGAGTGAACTATCACTTTGCTCCCGTGCTGTAGGTGGCGCACTGCATCAACCCGCGTGTGTTTCCAGTGTCTCCTTGAAGAACACACACATGCACACTGGTATCTGAGACACATTTTAGCTTGATATAAACTCTGGCGTTCAAAGCTCCGGAGGATGCCTCGGTA[T/A]GAGCTGTATATGGTCCTGAAGGCGATGCAGAGGCCGGAGACCGCGGCTGTTTTGCGGCGCACGGTGGAGACTTTGTTCGAGCGCGGCGCGGTGGTCCGGAGCCTGGAGAACCTCGGTGAACGCAAACTACCGTACAAGATCTCCAAACACGACTCTCGGCAATCACACGGCGGATATTTCTCCATTGACTTCCACGCGTCGCCGAACATAGTCAGCGGGCTGTTGAATCACCTTGAACGGGACGTTGACGTGCTGCGTCCGACGGTAGTAAAGAAAGACACGGAGCTCCCCAAAGGACAGTGCTGTGGAGTAGCTCGAGAAGTGAAAGCAAAGATGGCCAGTTAAATGTAAGATATCATCTGCTTTTTTTGCTCTGAGGATTTCAGTCCAAATATTCAAACATGGATATATCTGTGATATTCAACTAGCATGGTTAACAACATGGGGACCGTGTCATAAGTTGTATAAATGATATAAAACCAACGTTAACTTACCTCAAT
Associated Phenotype:
Not determined