Busch Lab

ZMP

slit1b

Ensembl ID:
ENSDARG00000039528
ZFIN ID:
ZDB-GENE-030722-4
Description:
slit homolog 1b [Source:RefSeq peptide;Acc:NP_001030147]
Human Orthologue:
SLIT1
Human Description:
slit homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:11085]
Mouse Orthologue:
Slit1
Mouse Description:
slit homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1315203]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa24209 Essential Splice Site Available for shipment Available now
sa43879 Nonsense Mutation detected in F1 DNA Not yet available
sa37562 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43880 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa45778 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37563 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6715 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24209
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Essential Splice Site 132 1102 5 27
ENSDART00000134281 None None 640 None 13
Genomic Location (Zv9):
Chromosome 22 (position 37593475)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34910029
GRCz11 22 34885778
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTTTCATAGCAGCTGTATTTTCTTCTGATTTCTTACATGCGTTGCCAT[A/T]GCAGCCAAGGAGCAGTATTACATCCCAGGTAAGTTAATTCAGGCTGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43879
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Nonsense 157 1102 6 27
ENSDART00000134281 None None 640 None 13
Genomic Location (Zv9):
Chromosome 22 (position 37593651)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34909853
GRCz11 22 34885602
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCTCAGAGGACACACGAATGAATAAGGACTGCAACAGCAAGCCTGTTTG[T/A]CCACCCAAATGCCGCTGTGAAGCTACCGTGGTGGACTGCTCCAATTTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37562
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Essential Splice Site 412 1102 11 27
ENSDART00000134281 None None 640 None 13
Genomic Location (Zv9):
Chromosome 22 (position 37601347)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34902309
GRCz11 22 34878058
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACACCTGTCCGCTCTCCCCCGCGGCGTCCCACTCAACGTCACCGAGCTG[T/C]GAGTGTTAACAGGACTCTTGGTGTCTTATCTGCCCTGCATTCAGGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43880
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Essential Splice Site 562 1102 17 27
ENSDART00000134281 Essential Splice Site 104 640 4 13
Genomic Location (Zv9):
Chromosome 22 (position 37611554)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34891723
GRCz11 22 34867472
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACAGCACAATGATAAGATCAAGTCAGAGAGTCAGTGTGTTCTCCCACA[G/T]GTCCAGTGGATGCGTCTGTGTCTGGGAAGTGCAGCCCGTGCTCGTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45778
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Essential Splice Site 603 1102 17 27
ENSDART00000134281 Essential Splice Site 145 640 4 13
Genomic Location (Zv9):
Chromosome 22 (position 37611681)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34891596
GRCz11 22 34867345
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACGACCCCCTTCACCAGTACAAGTGCAGCTGTCCACAGGGATACAAGG[T/C]GTGTTCACTACTGAGGGCACTTGAGAAGAGTACTGGAGAATATCTAACAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4187
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Nonsense 863 1102 23 27
ENSDART00000134281 Nonsense 405 640 10 13
Genomic Location (Zv9):
Chromosome 22 (position 37624271)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34879006
GRCz11 22 34854755
KASP Assay ID:
2261-7047.1 (used for ordering genotyping assays)
KASP Sequence:
ACAATGGTGTTAATGAGCACATCGCTGTGGAGCTGCATGACGGCCAYGTT[A/T]AAGTGACCTACGACGCTGGACGGCAACCCGGAAGCACCATTTACAGGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37563
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Essential Splice Site 930 1102 24 27
ENSDART00000134281 Essential Splice Site 472 640 11 13
Genomic Location (Zv9):
Chromosome 22 (position 37627807)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34875470
GRCz11 22 34851219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGGACACATCCAGCCGCTCACCAGAGACGCCCCGCTATATGTAGGCGG[T/C]AAGAAGATGATCACAAATAAAACAAATTGACGAGGTCTTTTGACTCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6715
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057752 Essential Splice Site 1032 1102 25 27
ENSDART00000134281 Essential Splice Site 574 640 12 13
Genomic Location (Zv9):
Chromosome 22 (position 37630005)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 34873272
GRCz11 22 34849021
KASP Assay ID:
554-4462.1 (used for ordering genotyping assays)
KASP Sequence:
CAGATCCTGCTCACTGCKGCCGCTGCCACAAACCCCTGCCAGAAACACAA[G/A]TGAGTGCCTGTCTGTTCACGACACCCATTTCAGATTAGACAAGGGAATAA
Associated Phenotype:
Not determined