Busch Lab

ZMP

ssx2ip

Ensembl ID:
ENSDARG00000039521
ZFIN ID:
ZDB-GENE-040426-1756
Description:
afadin- and alpha-actinin-binding protein [Source:RefSeq peptide;Acc:NP_957129]
Human Orthologue:
SSX2IP
Human Description:
synovial sarcoma, X breakpoint 2 interacting protein [Source:HGNC Symbol;Acc:16509]
Mouse Orthologue:
Ssx2ip
Mouse Description:
synovial sarcoma, X breakpoint 2 interacting protein Gene [Source:MGI Symbol;Acc:MGI:2139150]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa31249 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25732
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057742 Nonsense 97 576 3 13
Genomic Location (Zv9):
Chromosome 2 (position 1796983)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1652069
GRCz11 2 1994875
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTGAGTGCCGTGCCGGTGTTAAATCTGCTGTATGAAGTGCTGCAGCTG[C/T]AGAGGAGAGCTCAGCGCGGCCTGCAGGAGCTGGAGACTCAGCAGATAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31249
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057742 Nonsense 447 576 10 13
Genomic Location (Zv9):
Chromosome 2 (position 1805695)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 1660781
GRCz11 2 2003587
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGAACTTTGAGCGAGAAAGGAAGAATTTCACTGAAGCTGCCATTCGTT[T/A]GGGACACGAGGTAATCAATATTTTGTGTTTGTGTTTTGCAGGCGGGGATT
Associated Phenotype:
Not determined