Busch Lab

ZMP

c8b

Ensembl ID:
ENSDARG00000039517
ZFIN ID:
ZDB-GENE-070912-163
Description:
Novel protein similar to vertebrate complement component 8, beta polypeptide (C8B) [Source:UniProtKB
Human Orthologue:
C8B
Human Description:
complement component 8, beta polypeptide [Source:HGNC Symbol;Acc:1353]
Mouse Orthologue:
C8b
Mouse Description:
complement component 8, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:88236]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa19652 Nonsense Available for shipment Available now
sa32824 Nonsense Available for shipment Available now
sa15704 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19652
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057736 Nonsense 281 562 7 12
Genomic Location (Zv9):
Chromosome 2 (position 2524987)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2392639
GRCz11 2 1505057
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATCCGTGCTCACTCTGAGCTTGAGGTCGCTCGCTACGCTTTAAAACCA[C/T]AAAACCTGATGCTACACCCTGAGTTTGTGTCCCGACTGAACGCGCTGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32824
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057736 Nonsense 307 562 7 12
Genomic Location (Zv9):
Chromosome 2 (position 2524909)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2392561
GRCz11 2 1504979
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCCCGACTGAACGCGCTGCCGCTGGAGTACTCATACGGAGAATACCGG[C/T]AGATCTACCAAGACTACGGCACACATTTCATCAAGGAGGCAACTCTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15704
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057736 Nonsense 365 562 8 12
Genomic Location (Zv9):
Chromosome 2 (position 2524248)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2391900
GRCz11 2 1504318
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATTGTGTGCAGGTTGGGCTTAAGGTTGGAGTCCAGGYTAAAAAKATCTA[T/A]GTGGGACTTGGACTTTCAGGTGGAARCTGTGAAGGCCTGCTGAAAGAGAT
Associated Phenotype:
Not determined