Busch Lab

ZMP

c8a

Ensembl ID:
ENSDARG00000039516
ZFIN ID:
ZDB-GENE-040801-239
Description:
complement component C8 alpha chain [Source:RefSeq peptide;Acc:NP_001003496]
Human Orthologue:
C8A
Human Description:
complement component 8, alpha polypeptide [Source:HGNC Symbol;Acc:1352]
Mouse Orthologue:
C8a
Mouse Description:
complement component 8, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:2668347]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa2033 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2033
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057735 Nonsense 76 478 5 11
ENSDART00000132500 None None 123 None 4
ENSDART00000147283 Nonsense 190 592 5 11
Genomic Location (Zv9):
Chromosome 2 (position 2512150)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2379802
GRCz11 2 1492220
KASP Assay ID:
554-2611.1 (used for ordering genotyping assays)
KASP Sequence:
ACGCTTTAACTGGTTCTTTTGTGAGTCGAGTTCTGGACCCCAATTACGTG[G/T]GAGGCGTCTGTGAATACATCTATAATGGAGAATGGAGGAAACTYACATTC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6823
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057735 Nonsense 301 478 8 11
ENSDART00000132500 None None 123 None 4
ENSDART00000147283 Nonsense 415 592 8 11
Genomic Location (Zv9):
Chromosome 2 (position 2516485)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 2384137
GRCz11 2 1496555
KASP Assay ID:
554-4932.1 (used for ordering genotyping assays)
KASP Sequence:
TCAAAGCTACAGTGAAAGGAAAATCATGTGGAAAATTTACATCAAATGAG[A/T]AAAGTAYGTGACCTTGAGCCCCATTCATTTTCAATTCTTCTTTAGTGTTT
Associated Phenotype:
Not determined