Busch Lab

ZMP

zgc:63667

Ensembl ID:
ENSDARG00000039492
ZFIN ID:
ZDB-GENE-040426-1224
Description:
hypothetical protein LOC393451 [Source:RefSeq peptide;Acc:NP_956773]
Human Orthologue:
CYP46A1
Human Description:
cytochrome P450, family 46, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2641]
Mouse Orthologue:
Cyp46a1
Mouse Description:
cytochrome P450, family 46, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1341877]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa29302 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa36958 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa29302
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099258 Essential Splice Site 142 444 6 15
Genomic Location (Zv9):
Chromosome 20 (position 5301871)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5217464
GRCz11 20 5261871
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCGTCATGCACGACCTGGTCAACTGTGTTACACTTGATGTCATTTGCAAG[G/A]TTTCTCCATCCTTCTTATTGATCCAAGGGAAAGTCTAATGTGTCAAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36958
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099258 Nonsense 244 444 9 15
Genomic Location (Zv9):
Chromosome 20 (position 5299581)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5215174
GRCz11 20 5259581
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTCATCTTTTGTTGCAGAGGAAGAAAATGTTAATAACACAGATGATCTT[G/T]AGCAGATGTTGGACAATTTTGTGACTTTCTTTATAGCTGGTGAGTTACTC
Associated Phenotype:
Not determined