Busch Lab

ZMP

hk1

Ensembl ID:
ENSDARG00000039452
ZFIN ID:
ZDB-GENE-040426-2848
Description:
hexokinase-1 [Source:RefSeq peptide;Acc:NP_998417]
Human Orthologue:
HK1
Human Description:
hexokinase 1 [Source:HGNC Symbol;Acc:4922]
Mouse Orthologue:
Hk1
Mouse Description:
hexokinase 1 Gene [Source:MGI Symbol;Acc:MGI:96103]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa28104 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18424 Nonsense Available for shipment Available now
sa42187 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa28104
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057638 Essential Splice Site 165 918 4 18
Genomic Location (Zv9):
Chromosome 13 (position 23128377)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22857715
GRCz11 13 22988165
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTGGGCTTCACCTTCTCATTTCCTTGTTCACAAAGCAAACTGGATGAG[G/A]TAACAGAGAATCATTCACTCGTTAAATTCATTGTTCTACTACTGTATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18424
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057638 Nonsense 191 918 5 18
Genomic Location (Zv9):
Chromosome 13 (position 23128178)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22857516
GRCz11 13 22987966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTTCAAGGTTAATGGAGTAGAGGGAATGGATGTAGTGMAGCTTCTCAAT[A/T]AGGCCATTAAAAAACGTGGAGTGAGTATTATYAAGTCATTCTTTCTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42187
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057638 Essential Splice Site 740 918 15 18
Genomic Location (Zv9):
Chromosome 13 (position 23117453)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 22846791
GRCz11 13 22977241
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTATGACGATGCTGTGGATGACCTCTCCCTCAATGCCGGCAAACAAAA[G/A]TGAGCAGTTTTACTCAGTCATGGGTTGAGGAAAATTAAATGAAGCAGATG
Associated Phenotype:
Not determined