Busch Lab

ZMP

zgc:110353

Ensembl ID:
ENSDARG00000039443
ZFIN ID:
ZDB-GENE-050417-310
Description:
hypothetical protein LOC550482 [Source:RefSeq peptide;Acc:NP_001017785]
Human Orthologues:
ARRDC2, ARRDC3, ARRDC4, TXNIP
Human Descriptions:
arrestin domain containing 2 [Source:HGNC Symbol;Acc:25225]
arrestin domain containing 3 [Source:HGNC Symbol;Acc:29263]
arrestin domain containing 4 [Source:HGNC Symbol;Acc:28087]
thioredoxin interacting protein [Source:HGNC Symbol;Acc:16952]
Mouse Orthologues:
Arrdc2, Arrdc3, Arrdc4, Txnip
Mouse Descriptions:
arrestin domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918057]
arrestin domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2145242]
arrestin domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1913662]
thioredoxin interacting protein Gene [Source:MGI Symbol;Acc:MGI:1889549]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa16095 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16095
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057624 Nonsense 146 319 3 6
Genomic Location (Zv9):
Chromosome 8 (position 25103162)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24228980
GRCz11 8 24250219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTCTTTCCGTGCTGCRARCAAAGCTGAAGCAAAGTTCACGTTTGTCGCC[A/T]GAGCTGATTACGATCCATCAACAMTGACAGTATGCAGATTATCAGTGATA
Associated Phenotype:
Not determined