Busch Lab

ZMP

nt5c2a

Ensembl ID:
ENSDARG00000039399
ZFIN ID:
ZDB-GENE-030131-3566
Description:
5'-nucleotidase, cytosolic IIa [Source:RefSeq peptide;Acc:NP_958830]
Human Orthologue:
NT5C2
Human Description:
5'-nucleotidase, cytosolic II [Source:HGNC Symbol;Acc:8022]
Mouse Orthologue:
Nt5c2
Mouse Description:
5'-nucleotidase, cytosolic II Gene [Source:MGI Symbol;Acc:MGI:2178563]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa35506 Nonsense Mutation detected in F1 DNA Not yet available
sa5861 Nonsense Mutation detected in F1 DNA Not yet available
sa17723 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35506
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057574 Nonsense 225 403 9 18
ENSDART00000122754 Nonsense 225 551 9 18
ENSDART00000128370 Nonsense 227 563 8 17
Genomic Location (Zv9):
Chromosome 13 (position 28886822)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28532770
GRCz11 13 28663220
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATTTCAGGGCTCACTAAAGGAGAAAACGGTTGAAAACCTAGAGAAATA[T/A]GTGGTGAAAGATGTAAGCCAACCAGATTGTTGTGTAGACGTGAGCTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5861
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057574 Nonsense 272 403 12 18
ENSDART00000122754 Nonsense 272 551 12 18
ENSDART00000128370 Nonsense 274 563 11 17
Genomic Location (Zv9):
Chromosome 13 (position 28884953)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28530901
GRCz11 13 28661351
KASP Assay ID:
554-3789.1 (used for ordering genotyping assays)
KASP Sequence:
TCACATTCACAGACATTGAAAGACTAAATCTAATATTTCTTTATTACAGT[T/A]GGGTTCTCCTCATCGACCCTGGCAGTCCTACTTTGATCTTATTCTGGTGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7724
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057574 Nonsense 304 403 12 18
ENSDART00000122754 Nonsense 304 551 12 18
ENSDART00000128370 Nonsense 306 563 11 17
Genomic Location (Zv9):
Chromosome 13 (position 28884858)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28530806
GRCz11 13 28661256
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGTGGACGCCAGGAAGCCAATGTTTTTTGGGGAGGGCACAGTCTTGAGA[C/T]AAGTGGACACGGTAAGATCTGCTTAGACTCACAAGAGTAACTTTCAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17723
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057574 Nonsense 374 403 14 18
ENSDART00000122754 Nonsense 374 551 14 18
ENSDART00000128370 Nonsense 376 563 13 17
Genomic Location (Zv9):
Chromosome 13 (position 28884248)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28530196
GRCz11 13 28660646
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCTGAAGTCTAAGAAGCGTCAGGGTTGGAGAACGTTCCTGGTGAKTCCT[G/T]AGCTGGCTCAGGAGCTTCACGTTTGGACTGACAAGAGCAGTAAGTATKGA
Associated Phenotype:
Not determined