Busch Lab

ZMP

epha3l

Ensembl ID:
ENSDARG00000039373
ZFIN ID:
ZDB-GENE-060503-862
Description:
Novel protein similar to vertebrate EPH receptor A3 (EPHA3) [Source:UniProtKB/TrEMBL;Acc:Q1L8W1]
Human Orthologue:
EPHA3
Human Description:
EPH receptor A3 [Source:HGNC Symbol;Acc:3387]
Mouse Orthologue:
Epha3
Mouse Description:
Eph receptor A3 Gene [Source:MGI Symbol;Acc:MGI:99612]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa18943 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10403 Essential Splice Site Available for shipment Available now
sa25420 Nonsense Mutation detected in F1 DNA Not yet available
sa11139 Nonsense Available for shipment Available now
sa16865 Nonsense Available for shipment Available now
sa38730 Nonsense Mutation detected in F1 DNA Not yet available
sa41384 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18943
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006787 Essential Splice Site 52 712 1 14
ENSDART00000006787 Essential Splice Site 52 712 1 14
Genomic Location (Zv9):
Chromosome 9 (position 16828387)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16528322
GRCz11 9 16536034
KASP Assay ID:
2260-1652.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAAATTACTTTCGAGCAGACGAGGACCCTGCCTCCATGGCCTGCTCTC[G/A]TACGTGCTCTTATCTTACATACCCACATGTTTGTTTTGTTTAAACTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10403
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006787 Essential Splice Site 52 712 1 14
ENSDART00000006787 Essential Splice Site 52 712 1 14
Genomic Location (Zv9):
Chromosome 9 (position 16828387)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16528322
GRCz11 9 16536034
KASP Assay ID:
2260-1652.1 (used for ordering genotyping assays)
KASP Sequence:
GAAAAAYTACTTTCGAGCAGACGAGGACCCTGCCTCCATGGCCTGCTCTC[G/A]TACGTGCTCTTATCTTACATACCCACATGTTTGTTTTGYTTAAACTTTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8333
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006787 Nonsense 204 712 3 14
Genomic Location (Zv9):
Chromosome 9 (position 16855206)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16555141
GRCz11 9 16562853
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGCCAGAGAGACCCAATGGAATAATTCTGGACTATGAGGTCAAATACTA[T/A]GAGAAGGTGGGAGCAGTTTAATTTAGTCTCGCTTAGGGCACTCGCTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25420
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006787 Nonsense 239 712 4 14
Genomic Location (Zv9):
Chromosome 9 (position 16867048)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16566983
GRCz11 9 16574695
KASP Assay ID:
554-7721.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTACACTGAACGGACTGAAACCTGACACCACCTACCTGCTGCAGATC[A/T]GAGCTCGTACTGCTGCCGGTTACGGCAGCAGCAGCCGCAAGTTTGAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11139
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006787 Nonsense 496 712 10 14
Genomic Location (Zv9):
Chromosome 9 (position 16885671)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16585606
GRCz11 9 16593318
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAACATCCTGGTCAACAGCAATCTAKTGTGTAAAGTGTCAGACTTCGGCT[T/A]GTCCAGAGTGTTAGAGGATGACCCAGAAGCGGMCTACACAACAAGAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16865
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006787 Nonsense 508 712 10 14
Genomic Location (Zv9):
Chromosome 9 (position 16885708)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16585643
GRCz11 9 16593355
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAGACTTCGGCTWGTCCAGAGTGTTAGAGGATGACCCAGAAGCGGMCTA[C/A]ACAACAAGAGTAAGTTAACAYCTGTAGGAAMAAGGAGAGTTTTTTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38730
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006787 Nonsense 527 712 11 14
Genomic Location (Zv9):
Chromosome 9 (position 16891912)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16591847
GRCz11 9 16599559
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGGTGGCAAGATTCCAATCCGATGGACTGCGCCAGAAGCCATCGCCTA[T/A]CGCAAGTTCACCTCAGCCAGTGACGTATGGAGCTATGGGATTGTGCTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41384
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006787 Nonsense 658 712 13 14
Genomic Location (Zv9):
Chromosome 9 (position 16904915)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16604850
GRCz11 9 16612562
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTTCACACAATGGGAGATTGGCTGGAGAGTGCGAGGACGTTGCCCTGT[A/T]AAGATGCATTCAGCGGTGTTAGCTACAGCTCCTGTGATACACTGGCCAAA
Associated Phenotype:
Not determined