Busch Lab

ZMP

dnajb12

Ensembl ID:
ENSDARG00000039363
ZFIN ID:
ZDB-GENE-030131-2725
Description:
dnaJ homolog subfamily B member 12 [Source:RefSeq peptide;Acc:NP_997824]
Human Orthologue:
DNAJB12
Human Description:
DnaJ (Hsp40) homolog, subfamily B, member 12 [Source:HGNC Symbol;Acc:14891]
Mouse Orthologue:
Dnajb12
Mouse Description:
DnaJ (Hsp40) homolog, subfamily B, member 12 Gene [Source:MGI Symbol;Acc:MGI:1931881]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15775 Nonsense Available for shipment Available now
sa6308 Nonsense Mutation detected in F1 DNA Not yet available
sa10890 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15775
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057525 Nonsense 156 371 4 9
ENSDART00000136622 Nonsense 50 233 2 6
Genomic Location (Zv9):
Chromosome 13 (position 30262516)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29908464
GRCz11 13 30038914
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTCATTTGTTTTGTTTTTTTGGACTTCCAAYAGCTATAGGTAATGCGTA[C/A]GCAGTTCTTAGTAACCCTGAAAAAAGAAGGCAGTAWGATGTCTAMGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6308
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057525 Nonsense 168 371 4 9
ENSDART00000136622 Nonsense 62 233 2 6
Genomic Location (Zv9):
Chromosome 13 (position 30262552)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29908500
GRCz11 13 30038950
KASP Assay ID:
554-4783.1 (used for ordering genotyping assays)
KASP Sequence:
ATAGGTAATGCGTACGCAGTTCTTAGTAACCCTGAAAAAAGAAGGCAGTA[T/A]GATGTCTACGGTGAAGAAAAAGCTCAYCCTACTCACAGGCACAGGACCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10890
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057525 Nonsense 171 371 4 9
ENSDART00000136622 Nonsense 65 233 2 6
Genomic Location (Zv9):
Chromosome 13 (position 30262561)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29908509
GRCz11 13 30038959
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCGTACGCAGTTCTTAGTAACCCTGAAAAAAGAAGGCAGTAWGATGTCTA[C/A]GGTGAAGAAAAAGCTCAYCCTACTCACAGGCACAGGACCTATCATAGAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4508
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057525 Essential Splice Site 330 371 7 9
ENSDART00000136622 Essential Splice Site 224 233 5 6
Genomic Location (Zv9):
Chromosome 13 (position 30265275)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 29911223
GRCz11 13 30041673
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACTATATATCCAAKCTGAGAAACAACTGCTGGAAGGARAAACAGCAAA[G/T]TATGTGACACTAACTCTACTTGTAGGTTCTCGAATGAATATTCTGAAAKC
Associated Phenotype:
Not determined