Busch Lab

ZMP

ahcyl2

Ensembl ID:
ENSDARG00000039343
ZFIN ID:
ZDB-GENE-040115-5
Description:
putative adenosylhomocysteinase 3 [Source:RefSeq peptide;Acc:NP_958497]
Human Orthologue:
AHCYL2
Human Description:
adenosylhomocysteinase-like 2 [Source:HGNC Symbol;Acc:22204]
Mouse Orthologue:
Ahcyl2
Mouse Description:
S-adenosylhomocysteine hydrolase-like 2 Gene [Source:MGI Symbol;Acc:MGI:1921590]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa33371 Nonsense Mutation detected in F1 DNA Not yet available
sa8809 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10583 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33371
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130453 Nonsense 156 623 2 17
Genomic Location (Zv9):
Chromosome 4 (position 4922108)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5040289
GRCz11 4 5048859
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGAAGCAAGAGTTCAACAAACGTCCCACCAAGATCGGCCGCAGGTCTT[T/A]GTCCCGCTCCATCTCACAATCTTCAACGGACAGTTACAGCTCAGGTACGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26208
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130453 Nonsense 572 623 15 17
Genomic Location (Zv9):
Chromosome 4 (position 4901822)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5020003
GRCz11 4 5028573
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGCTCTGGCTCTGATAGAGCTCTACAATGCTCCCGAGGGCCGCTACAAA[C/T]AGGACGTCTACCTGCTGCCGAAGAAAATGGGTGGGATATTTGTTTTAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8809
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130453 Essential Splice Site 581 623 15 17
Genomic Location (Zv9):
Chromosome 4 (position 4901791)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5019972
GRCz11 4 5028542
KASP Assay ID:
2259-4423.1 (used for ordering genotyping assays)
KASP Sequence:
TCCCGAGGGCCGCTACAAACAGGACGTCTACCTGCTGCCGAAGAAAATGG[G/A]TGGGATATTTKTTTTNAGAAATACATGCACAGTAAGATGCTTTGTGTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10583
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130453 Nonsense 584 623 16 17
Genomic Location (Zv9):
Chromosome 4 (position 4899827)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5018008
GRCz11 4 5026578
KASP Assay ID:
2259-4422.1 (used for ordering genotyping assays)
KASP Sequence:
MATGATTCTAGATGATGTGAATTTGCTTATGCWTTTTCTRCAGATGAGTA[T/A]GTGGCCAGCCTTCATCTCCCTACATTTGATGCACACCTGACTGAACTGTC
Associated Phenotype:
Not determined