Busch Lab

ZMP

fbln5

Ensembl ID:
ENSDARG00000039273
ZFIN ID:
ZDB-GENE-041010-54
Description:
fibulin-5 [Source:RefSeq peptide;Acc:NP_001005979]
Human Orthologue:
FBLN5
Human Description:
fibulin 5 [Source:HGNC Symbol;Acc:3602]
Mouse Orthologue:
Fbln5
Mouse Description:
fibulin 5 Gene [Source:MGI Symbol;Acc:MGI:1346091]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa31943 Nonsense Available for shipment Available now
sa22340 Nonsense Available for shipment Available now
sa31942 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28154
Status:
No KASP design
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057382 Essential Splice Site 49 477 3 11
Genomic Location (Zv9):
Chromosome 13 (position 33392431)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33038379
GRCz11 13 33168829
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGTGCTCAGATGGGTTTACTTTTGATCGTCGTTCCAGACAGTGTATGG[G/A]TAAGTGGCTCATCTCTTATGTTATTAAAATTTACATTAAGAACTTGTATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28153
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057382 Nonsense 111 477 4 11
Genomic Location (Zv9):
Chromosome 13 (position 33392163)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33038111
GRCz11 13 33168561
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGAGGCTTCCTATCCTGAAGAGCCCTACCCTGACAGATCACTGGGTTA[T/A]TCTGAAACATACAGTGCTCCTGTGGCTCCTGTGGCTCCTGGCCCTGGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31943
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057382 Nonsense 134 477 4 11
Genomic Location (Zv9):
Chromosome 13 (position 33392094)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33038042
GRCz11 13 33168492
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGTGGCTCCTGTGGCTCCTGGCCCTGGTCCAGGCCCTGGTCCCAGTTA[C/A]CCAATAGTGAGTCGAACCACTCCCTGTCTCCTTGGATATACATTCGGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22340
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057382 Nonsense 181 477 5 11
Genomic Location (Zv9):
Chromosome 13 (position 33384384)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33030332
GRCz11 13 33160782
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACATCAGTGTAACCCTACTCAGGTGTGTATAAATACAGCCGGTGGATA[T/A]ACCTGCTCGTGTACTGAGGGCTACTGGCTGGTGGGAGGACAGTGCCAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31942
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057382 Essential Splice Site 275 477 7 11
Genomic Location (Zv9):
Chromosome 13 (position 33383220)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 33029168
GRCz11 13 33159618
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCTGTGATGAAGGCTTTGAGCTTGCCGCTGATGGCACCACCTGCAATG[G/A]TAAAGGAGGAAGATAAGGTCCAGTTTAGAGGTTTTAGAGAAAGTTTAAAG
Associated Phenotype:
Not determined