Busch Lab

ZMP

arhgap4a

Ensembl ID:
ENSDARG00000039265
ZFIN ID:
ZDB-GENE-040426-1229
Description:
Rho GTPase activating protein 4 [Source:RefSeq peptide;Acc:NP_956738]
Human Orthologue:
ARHGAP4
Human Description:
Rho GTPase activating protein 4 [Source:HGNC Symbol;Acc:674]
Mouse Orthologue:
Arhgap4
Mouse Description:
Rho GTPase activating protein 4 Gene [Source:MGI Symbol;Acc:MGI:2159577]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa1484 Nonsense Available for shipment Available now
sa45802 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa37711 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17901 Essential Splice Site Available for shipment Available now
sa29931 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa1484
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050420 Nonsense 195 917 6 24
ENSDART00000145307 Nonsense 195 917 6 24
Genomic Location (Zv9):
Chromosome 23 (position 25287861)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25073981
GRCz11 23 25000522
KASP Assay ID:
554-1409.1 (used for ordering genotyping assays)
KASP Sequence:
TCAAACTGGAGGAAAAGCAAAAACAGAGTGCTTCTAAAAAGATGGAAAGA[C/T]AAATAGAGAAAGTATGTATAGTTTTGCTTTATTAGCAAAATAGGAAATGG
Long Flanking Sequence:
CTTCTGAGATGATGATAATAATAATAACAAAATGCAATGCTTTGGCTGAAAAAATAAAAACAAAAATTAAAAACAGAAGTGTAGCATGAGAATTAAACAATCTCTTCCCTCCAACAAATAATAAATACAAATCCACAGAGAAACAAAACTGTAGCTTAAAAAGATCAGATTTTCGATCCAATAAGGAAACTTTCTCTTTTTTTTTTATGTTTTCAGAGCAGGGAAATCTGCACCCTGTTACAGGATGGGCTTTTGAAGGTCACCATAGAGCTTCATACAGTGAGTTTAAGTTTGTCATTAAGTCACACTTTTTTTGTGTATGAATTATGATTCTTGTGTTTATAGTTAATGTCAAATGTATTCCTATGTTTGTTGAAAACCAGACCTTGAAGACATATTACCAGTATTATACTGAGTTCCTGTCTGCAGAAGGCAAACTGAAGGAGGCTGTCAAACTGGAGGAAAAGCAAAAACAGAGTGCTTCTAAAAAGATGGAAAGA[C/T]AAATAGAGAAAGTATGTATAGTTTTGCTTTATTAGCAAAATAGGAAATGGTTGTAAATCAAATCAAAATGGTTGTTCAATACAACTCAGCTGAAGAGGAATGTTGATTACTAAAATGAATATCCAGATCTTCCTTTTAAAAAAGCACAGTTACAGTAAAGCATTTTAAAAAGTTATTATTCATGTGGTGCGTTTAAGTCAACCTATAGGAAGTTTGTATTCATGAGCTGGAAAACAAAAGTACATAGTCAGGAATGTTTAATCCACTTTGGCATAAATTTTAAGAAGATGATTTATGGAAAGAGATTGTACTTTTGTATTTGAGTTTTTCTGTTATTATTCAAGTTCTGTTTTTAACTAAATCTGTGGTGGTCAACCCATATGTATAATTATGTCTTCCTGGATCACTTTTTCATGATGTGAGCTTAATGAATTCTAGCATTGCCCTTCTAGAATATGCCTGTATGAAGAAAAGGGAAGAAAAAATCCATTGATATAATA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa45802
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050420 Essential Splice Site 412 917 10 24
ENSDART00000145307 Essential Splice Site 412 917 10 24
Genomic Location (Zv9):
Chromosome 23 (position 25292089)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25078209
GRCz11 23 25004750
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGAAGCGTAGAGCCAGCCTTCCGGATGCTGAGAGCTTGTACTTCACGG[T/C]AATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAT
Long Flanking Sequence:
ACCCTAGACTAATAACTGTGGTGCAAAAATATGCATGTCCTCCTCCAGGTGGTTGAGGTGTCTGCAAAATGTGAGATGATGAGTGAGCTGGTGACTCGCGTCCAGCAGCTGCAGTCCAGACTCTCTTCAGTCACTCTGGAGGTTGAGGAGGTACACAAACTACACAATCTCTACACTATACAGACAAAAATGTCACAGTTATCACAGTGTAGATGAGACAATAATCAGATGAATTTGATTAATTGTATTTTTGTTTACTCTTTACATTTTGACTTGTGTAAATATAAATATACATTTGAATATTTTGCAGTCTGGCAAATTACTTCAGTCAGCTCAATCTTCCATTCTGGAGAGTCTTGCTGAGATCGCTTTTGGATCCACTCCTGACTTTCCCAGCAGCCCTTCATCACCAGAGGGGAACAGCGATGTGTCTGCTAATAAGAACTTCACACTGAAGCGTAGAGCCAGCCTTCCGGATGCTGAGAGCTTGTACTTCACGG[T/C]AATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCAATCATTATTACATTTTAATTATATAAAATGTGGGTAGCATGGTGGCTCAGTGGTTAGCACTGTCGCCTCACACCAAGAAGGTCACTGGTTCGAGCTCCTGCTGGGTCAGTTTCTGTGTGTTTTCTCCATGTTCGCATGGGTTACCTCTGGGTGCTCTGGTTTTCCCTACAGTCCAAAGACATGCAGTACAGGTGAATTGAATAAACTAAATTGGCCGTAGTGTATGTGTGTGAATGCAAGAGTTTATGGATGTTTCCCAGTGCTGGGTTGTGGCTGGAAGGGCATACTCTGCGTAAAGCATATACTGGATAAGTTGGCGGTTCATTCCACGGTGGCAACACCTGATAAATAAAGGGACTAAGCCAGGCATGTCCAAACTCGATCCTGGAGGGCCGGTTTCCTGCAAAGTTTAGTTCCAGCCCCAATCAGACACACCTGGGCTAGCTAATCAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37711
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050420 Essential Splice Site 571 917 16 24
ENSDART00000145307 Essential Splice Site 571 917 16 24
Genomic Location (Zv9):
Chromosome 23 (position 25295061)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25081181
GRCz11 23 25007722
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAACCCCTCTTTCCCGAGGACAGTTATGACCAGCTGATGGAATGTGGAC[G/A]TAAGAGGACTTCATCATGCTAATATGGGATTAAATGCTGGCTTAGAACTC
Long Flanking Sequence:
TGATGATATTCTCCTCCTTTTCTTTAAACATTAGTAATGCTATGGACCATTGGGCAGAATTAATGGTCTTTAATAGTTAGAAATTCCTTTTTATTTTAAGGAATTAAATGAGTAAAGGATTTTAAGGGGTAGTTCACACAAAATTGAAAGTTACGTCAACTGACAAAAGAAGATACTTTGAAGGTGTAACATACAAAGTATGGTAGCCATTGACTTCCATAGTATTTGTTTTCTTATTTCCTTATTCTATTTCATTTATATAAGAGTTATATTATAACTTAGCTACTTGCGCTACATCCTACCTCATACCTTCAATGTTAAAAACTGAAGCTTATACAGTATATACACACTCACTTTATTTTTTTCTGTAGGTGATGATCCTCTTACTGATGAACGGTGTGACATGGACTCTGTGGCTGGAGTGCTGAAGCTTTATTTTCGAGGCCTAGAGAAACCCCTCTTTCCCGAGGACAGTTATGACCAGCTGATGGAATGTGGAC[G/A]TAAGAGGACTTCATCATGCTAATATGGGATTAAATGCTGGCTTAGAACTCCCAACAACATTATTTTGCTCAATAGTGCATGACTGAAAATATTACGTTTATTCATAAAATCGATGTATTCATGAATCAAAAAGGACAGTATAGGTATTTCATAATGTTCCAAAAGGTTTCTGCTTCAAATGCATTTGGACAAATACAGGACTGCCAACTTTTGGTTTCACCTTGGAGTGAGATTTTTTTTTGTCCCGACTCCTAAAATATACTGATATATACTGTTATTATCGCCCAAAAAAGTAAGGGTGGTTATTGGGTCGAGTAGTAGTGAAGACAGAGTGGTGGGTGATTCGACCGTTTTCAACATTGATGATAATAATAGTACTACTTCAACTGCTGCTGCTGCTAATAAATCAGAATAGTTCTTTTAGCTGCAAATCAGCTTTTGAAAATGATATTTAGATCATGTAGCACAGAAAATTAAATTAAAATGTAAAATTTGATTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29930
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050420 Nonsense 695 917 19 24
ENSDART00000145307 Nonsense 695 917 19 24
Genomic Location (Zv9):
Chromosome 23 (position 25299659)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25085779
GRCz11 23 25012320
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTATGTCTATAGTGAAGCTGTAGCAGAGGAAGGAGATGGAGAATCAGAG[C/T]AGGTTCAAATAAAAGAACCAAAAGACGGTAAGCTTGACATGGTTTACTTA
Long Flanking Sequence:
AATCAGTTTTGTTGCTCGAGTATATTTTTGTCAGTAGACAAGATTACATTGTATGGGTAAAAATGATTATTTTTCTTTTAATAGAATCTTAAGTACAGAAAATGTTACATGAAGGCAAATTTCAATCTGTAAATTTATTAAAACTAAAATAATATTAAACATTTAACTTGAACCCTCAGATTCCAGATTTTCAAATAGTTTTATCTCAAACAAATATTGTAGACTAACAAACAACACATCAATTAAAAGCTTATTTGTTCAGCTTTCATGTGTTTTATTAATGAATAAAAATAACTCTTGTGTCTGGTTTTGTGGTCCAGGGCCACACATTATTGACAGCTAATCTGCTAAATTCAAAAACATTATAAACATTAACATTATGATTTCCCTGTAAAGCTGCTTTAAATCAGTCGTGCACTGAGAAAAATATTTACATTCAACTTATTATTTCTTATGTCTATAGTGAAGCTGTAGCAGAGGAAGGAGATGGAGAATCAGAG[C/T]AGGTTCAAATAAAAGAACCAAAAGACGGTAAGCTTGACATGGTTTACTTATCAGCATTCAGACTAGTAGAACTAAACTAATTACTTTTGGTCTGTTTCTGGATGTGCAGAGCTGCAGGCACTGGCCCTGTTTGACTACATAGGCCGTTCTTCAACTGAGCTGTCCTTCAAACACGGCGATCGCTTCATTGTATACAGCAAAGCCTCCTCTGATTGGTGGAAAGGCGAAGTGAATGGGTCAAAGGGTCTCATCCCAAATAAATATATCAGTGTGCAGAGGTAGGTTCTCATCTCTTGGACTAGAATGCTCTGTCAGATATGTAAATAAATCTCTCTTTTGTTGTAATTGTGACACAAATTAAATGTAAAGCCACATTTAGCTGTATCATTATAGTATATTGGCAGATAAAAATAACTATATTTAATTTGAGCCATTATAATTATAATGTCCCAGCAGACACCCAACATCATAAGACATTAATATTAGGTTAGATTTAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17901
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050420 Essential Splice Site 703 917 19 24
ENSDART00000145307 Essential Splice Site 703 917 19 24
Genomic Location (Zv9):
Chromosome 23 (position 25299687)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25085807
GRCz11 23 25012348
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAGGAGATGGAGAATCAGAGCAGGTTCAAATAAAAGAACCAAAAGAYG[G/A]TAAGSTTGAMATGGTTKACTTATCAGCATTCWGACTARTAGAACTAAACT
Long Flanking Sequence:
TGTCAGTAGACAAGATTACATTGTATGGGTAAAAATGATTATTTTTCTTTTAATAGAATCTTAAGTACAGAAAATGTTACATGAAGGCAAATTTCAATCTGTAAATTTATTAAAACTAAAATAATATTAAACATTTAACTTGAACCCTCAGATTCCAGATTTTCAAATAGTTTTATCTCAAACAAATATTGTAGACTAACAAACAACACATCAATTAAAAGCTTATTTGTTCAGCTTTCATGTGTTTTATTAATGAATAAAAATAACTCTTGTGTCTGGTTTTGTGGTCCAGGGCCACACATTATTGACAGCTAATCTGCTAAATTCAAAAACATTATAAACATTAACATTATGATTTCCCTGTAAAGCTGCTTTAAATCAGTCGTGCACTGAGAAAAATATTTACATTCAACTTATTATTTCTTATGTCTATAGTGAAGCTGTAGCAGAGGAAGGAGATGGAGAATCAGAGCAGGTTCAAATAAAAGAACCAAAAGACG[G/A]TAAGCTTGACATGGTTTACTTATCAGCATTCAGACTAGTAGAACTAAACTAATTACTTTTGGTCTGTTTCTGGATGTGCAGAGCTGCAGGCACTGGCCCTGTTTGACTACATAGGCCGTTCTTCAACTGAGCTGTCCTTCAAACACGGCGATCGCTTCATTGTATACAGCAAAGCCTCCTCTGATTGGTGGAAAGGCGAAGTGAATGGGTCAAAGGGTCTCATCCCAAATAAATATATCAGTGTGCAGAGGTAGGTTCTCATCTCTTGGACTAGAATGCTCTGTCAGATATGTAAATAAATCTCTCTTTTGTTGTAATTGTGACACAAATTAAATGTAAAGCCACATTTAGCTGTATCATTATAGTATATTGGCAGATAAAAATAACTATATTTAATTTGAGCCATTATAATTATAATGTCCCAGCAGACACCCAACATCATAAGACATTAATATTAGGTTAGATTTAGGTCACCAGCATCTAGGGACAATGATATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29931
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050420 Essential Splice Site 793 917 21 24
ENSDART00000145307 Essential Splice Site 793 917 21 24
Genomic Location (Zv9):
Chromosome 23 (position 25301876)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 25087996
GRCz11 23 25014537
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGCAGACACCAGACAGAGGAAGAAGTGAAAGCTGAGAAAAGCACAAGG[T/C]AAGACATCATGTGTACTGTCGTATGTACAAAAAAACTTTTCTTCGTACTC
Long Flanking Sequence:
AAAATATGCTTAAACGAATGTCTTCTGTGGTTCTTGGAGCATTATTTTATATTTGCAAAAGCATTACCTAAAAATAAAAAAATAACCACAAAGGAACATCTTGTATAGATTATATTCAGGTTATTTTAAAATAACCACCTTGCAAAGTTCTGAGACTGTTATTTTAAGGTTGCAAAATAACATTGCCCTAATGCAATTTTTTTGTTATTTAAAAAAACACCATAAACTAATGTTAGAGGTTTTGGGCATTAAATAAATTGACCAAAACTTTACTTAATAATTTTACCTAAAATACCATTAGGAATAACATAAATATCATCGAGCCACAATCAGAATCAGTGCTACAAATTACAGTCCAGATAGTCATAACACCCCTCAATCTTCTCTTATTGTTGTTCAGTGTGGATGGAGGCCAAGATCAGAAAGGGAAGGAAACTCTGAAATCCAGCTGTGGCAGACACCAGACAGAGGAAGAAGTGAAAGCTGAGAAAAGCACAAGG[T/C]AAGACATCATGTGTACTGTCGTATGTACAAAAAAACTTTTCTTCGTACTCTGTTTTTCTTAAGTTTTAGTAATGCATCCTATTTAGCCTGTTAAGTGTACACAGCCTATATAAATAAAGGAAATGAATTCTACTCTAAAAAATGAACCTTCTTTCGTAATGATGACCAATAGTAACAAGATAAACTCCAAAGTATTTCTGCCTTTTTTTGTTAATTCATTTTCCAGATTAAAGGTCACGACTGACAAAGCCGGGGTCGGACCTAGTCAAGTCACCTCAGGAAAAATTTGTTTGCAATTACCCACAGGACAATTTATACAGCCAGGAAATTCTCCAGGTGCTCTGCGGAAAACATTAGAGTAAGTAATTAGACTATTTTTAACAGTTTATTATTGTTTATTGAATAATGACTAGATTTGTTGAATCGTAACTTCAACAGTCCTCAAATGAGACGATCCACTACTGAAGGAGGAAGTAGGGAGGAATGCTCAACAGATGTGG
Associated Phenotype:
Not determined