Busch Lab

ZMP

speg

Ensembl ID:
ENSDARG00000039256
ZFIN ID:
ZDB-GENE-030131-3230
Description:
Striated muscle preferentially expressed protein kinase [Source:UniProtKB/Swiss-Prot;Acc:Q696W0]
Human Orthologue:
SPEG
Human Description:
SPEG complex locus [Source:HGNC Symbol;Acc:16901]
Mouse Orthologue:
Speg
Mouse Description:
SPEG complex locus Gene [Source:MGI Symbol;Acc:MGI:109282]

Alleles

There are 19 alleles of this gene:

Allele Name Consequence Status Availability
sa25334 Nonsense Mutation detected in F1 DNA Not yet available
sa13872 Nonsense Available for shipment Available now
sa14081 Nonsense Available for shipment Available now
sa26736 Nonsense Mutation detected in F1 DNA Not yet available
sa40677 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40678 Nonsense Mutation detected in F1 DNA Not yet available
sa40679 Nonsense Mutation detected in F1 DNA Not yet available
sa12597 Nonsense Available for shipment Available now
sa14625 Essential Splice Site Available for shipment Available now
sa40680 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa7040 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40681 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40682 Nonsense Mutation detected in F1 DNA Not yet available
sa7581 Missense Mutation detected in F1 DNA Not yet available
sa9635 Essential Splice Site Available for shipment Available now
sa45251 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25334
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Nonsense 278 2995 5 38
ENSDART00000133507 Nonsense 278 2995 5 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22803963)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19059409
GRCz11 6 21119631
KASP Assay ID:
554-7839.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCATCCTCTATCCAAACTCCCAAAGTGTCACAGGCAAGTTCCAAAATTT[T/A]AGACAGAGTGAGAGCATTTGAAGAACAAAGCCACAACAGTAACATGCCAA
Long Flanking Sequence:
GCTTTAGGTGTGACTTATTTTGTTTTCTGATTGCAATCTTTTTGATTTATTCAGCTCCCACATTTTAAATATTTCACCATTTGATGTTTTTTAATGCATGATTTGTTTGGTTTCTATTACTTAAATATGCTTTCACTCAAAAAAACATGCATGAGTAGCAAATCTGTGCACCCATTTTTTCCATTTTTATTTTCTGTCATAACACAACATCTTCCACAATCACCCTCATTTCAGGGGCCAATTGGATTTTAAAACAAGTGAAGCCTCACCATTTGTCCAAACCCAGCCACCTCACAAAGCTCAAGCCTCCATTACCAAAAGTGATGTAGATGCAACAATAGACTCAACAGCAACAAAGATTAAAGGCACCAAAACAGCCATGAATGGAGCTGAGGTCTCTATTAAATCTTCAAAAATCACAGGTTCACATCAGAGCGGTGGTTCACAAGATCCATCCTCTATCCAAACTCCCAAAGTGTCACAGGCAAGTTCCAAAATTT[T/A]AGACAGAGTGAGAGCATTTGAAGAACAAAGCCACAACAGTAACATGCCAAAGGTGTCTTCAAGATTGTCATGGGGTTTCAATAGAACATCATCTTGCAATTCTGAGGATGAGACATGTAAAGCAGGGAAATTCCAAGCCAACACAAAGAGTGATGTAGCACTCAAGAGGTCTTTTTTCAAGCAGAAAGCATCCTCTCTAGAGGAACAGTCGACTTGTGTGCAGAAAAATTTTCAGAGTAAACTCTCCGAAGAGCTTCACAGAATAAAGAAACTAGTTGGAAAATCCAACATCAAGAAAGCCTTTTCAATGGAGCAGCTCACCCAGACCGACAAGCAGTCCAGTGTCAGCACAGAGTCAGTTCTAACGCAAGTAATTCAGAAGACTGAAGAAACTGGAAAGCATTTCACTAATTTAAAAGCTGTACCAGATGCAAAGGAAAGATGGACAACCCTGCCAAAGGAGCAATCTTCCCGATTACCAAAAATTAACCTGGCAGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13872
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Nonsense 436 2995 5 38
ENSDART00000133507 Nonsense 436 2995 5 38
ENSDART00000137461 None None 164 None 4
ENSDART00000029697 Nonsense 436 2995 5 38
ENSDART00000133507 Nonsense 436 2995 5 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22804436)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19059882
GRCz11 6 21120104
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACCAGATGCAAAGGAAAGRTGGACARCCCTGCCAAAGGAGCAATCTTCC[C/T]GATTACCAAAAATTAACCTGGCAGATAAAACAAAACWGCCTSAAAATGAA
Long Flanking Sequence:
AAGTGTCACAGGCAAGTTCCAAAATTTTAGACAGAGTGAGAGCATTTGAAGAACAAAGCCACAACAGTAACATGCCAAAGGTGTCTTCAAGATTGTCATGGGGTTTCAATAGAACATCATCTTGCAATTCTGAGGATGAGACATGTAAAGCAGGGAAATTCCAAGCCAACACAAAGAGTGATGTAGCACTCAAGAGGTCTTTTTTCAAGCAGAAAGCATCCTCTCTAGAGGAACAGTCGACTTGTGTGCAGAAAAATTTTCAGAGTAAACTCTCCGAAGAGCTTCACAGAATAAAGAAACTAGTTGGAAAATCCAACATCAAGAAAGCCTTTTCAATGGAGCAGCTCACCCAGACCGACAAGCAGTCCAGTGTCAGCACAGAGTCAGTTCTAACGCAAGTAATTCAGAAGACTGAAGAAACTGGAAAGCATTTCACTAATTTAAAAGCTGTACCAGATGCAAAGGAAAGATGGACAACCCTGCCAAAGGAGCAATCTTCC[C/T]GATTACCAAAAATTAACCTGGCAGATAAAACAAAACAGCCTGAAAATGAAACACCCCCTGAAATGAATGAAAACCAGGAGAACAATTCTAAGCCTATACAGTTGTTAGATGGGCAAGTCCTCAATGAAAAGGTCAGCTTCATACCAGGGCAATGTTCACCAATGTTGCCTAGGACAAATGTTTCCAGAAAATGGCCAAAATCACCTGCCCAACCTATGGTGAAAGATGGTTTGGTGAAAGCCCCACAAAAGCCTCCAAGATTATTAGAATCAATTTCCACACTACCAACACCATTTAAAATGACCATACCTACTATTGTGGTTGAAAATAAGCCCGTGGATGAAGAGTTGGACCAAAAGGAAGGACAAATAATGAGACAAAACAGAGGTAAAAGTTTTTCCTGAACTTCTACCAGCTTCTTTGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGGCCAGATAGGGTAAAATATGAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14081
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Nonsense 436 2995 5 38
ENSDART00000133507 Nonsense 436 2995 5 38
ENSDART00000137461 None None 164 None 4
ENSDART00000029697 Nonsense 436 2995 5 38
ENSDART00000133507 Nonsense 436 2995 5 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22804436)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19059882
GRCz11 6 21120104
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACCAGATGCAAAGGAAAGRTGGACARCCCTGCCAAAGGAGCAATCTTCC[C/T]GATTACCAAAAATTAACCTGGCAGATAAAACAAAACWGCCTSAAAATGAA
Long Flanking Sequence:
AAGTGTCACAGGCAAGTTCCAAAATTTTAGACAGAGTGAGAGCATTTGAAGAACAAAGCCACAACAGTAACATGCCAAAGGTGTCTTCAAGATTGTCATGGGGTTTCAATAGAACATCATCTTGCAATTCTGAGGATGAGACATGTAAAGCAGGGAAATTCCAAGCCAACACAAAGAGTGATGTAGCACTCAAGAGGTCTTTTTTCAAGCAGAAAGCATCCTCTCTAGAGGAACAGTCGACTTGTGTGCAGAAAAATTTTCAGAGTAAACTCTCCGAAGAGCTTCACAGAATAAAGAAACTAGTTGGAAAATCCAACATCAAGAAAGCCTTTTCAATGGAGCAGCTCACCCAGACCGACAAGCAGTCCAGTGTCAGCACAGAGTCAGTTCTAACGCAAGTAATTCAGAAGACTGAAGAAACTGGAAAGCATTTCACTAATTTAAAAGCTGTACCAGATGCAAAGGAAAGATGGACAACCCTGCCAAAGGAGCAATCTTCC[C/T]GATTACCAAAAATTAACCTGGCAGATAAAACAAAACAGCCTGAAAATGAAACACCCCCTGAAATGAATGAAAACCAGGAGAACAATTCTAAGCCTATACAGTTGTTAGATGGGCAAGTCCTCAATGAAAAGGTCAGCTTCATACCAGGGCAATGTTCACCAATGTTGCCTAGGACAAATGTTTCCAGAAAATGGCCAAAATCACCTGCCCAACCTATGGTGAAAGATGGTTTGGTGAAAGCCCCACAAAAGCCTCCAAGATTATTAGAATCAATTTCCACACTACCAACACCATTTAAAATGACCATACCTACTATTGTGGTTGAAAATAAGCCCGTGGATGAAGAGTTGGACCAAAAGGAAGGACAAATAATGAGACAAAACAGAGGTAAAAGTTTTTCCTGAACTTCTACCAGCTTCTTTGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGGCCAGATAGGGTAAAATATGAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26736
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Nonsense 466 2995 5 38
ENSDART00000133507 Nonsense 466 2995 5 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22804526)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19059972
GRCz11 6 21120194
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGAAAATGAAACACCCCCTGAAATGAATGAAAACCAGGAGAACAATTCT[A/T]AGCCTATACAGTTGTTAGATGGGCAAGTCCTCAATGAAAAGGTCAGCTTC
Long Flanking Sequence:
GATTGTCATGGGGTTTCAATAGAACATCATCTTGCAATTCTGAGGATGAGACATGTAAAGCAGGGAAATTCCAAGCCAACACAAAGAGTGATGTAGCACTCAAGAGGTCTTTTTTCAAGCAGAAAGCATCCTCTCTAGAGGAACAGTCGACTTGTGTGCAGAAAAATTTTCAGAGTAAACTCTCCGAAGAGCTTCACAGAATAAAGAAACTAGTTGGAAAATCCAACATCAAGAAAGCCTTTTCAATGGAGCAGCTCACCCAGACCGACAAGCAGTCCAGTGTCAGCACAGAGTCAGTTCTAACGCAAGTAATTCAGAAGACTGAAGAAACTGGAAAGCATTTCACTAATTTAAAAGCTGTACCAGATGCAAAGGAAAGATGGACAACCCTGCCAAAGGAGCAATCTTCCCGATTACCAAAAATTAACCTGGCAGATAAAACAAAACAGCCTGAAAATGAAACACCCCCTGAAATGAATGAAAACCAGGAGAACAATTCT[A/T]AGCCTATACAGTTGTTAGATGGGCAAGTCCTCAATGAAAAGGTCAGCTTCATACCAGGGCAATGTTCACCAATGTTGCCTAGGACAAATGTTTCCAGAAAATGGCCAAAATCACCTGCCCAACCTATGGTGAAAGATGGTTTGGTGAAAGCCCCACAAAAGCCTCCAAGATTATTAGAATCAATTTCCACACTACCAACACCATTTAAAATGACCATACCTACTATTGTGGTTGAAAATAAGCCCGTGGATGAAGAGTTGGACCAAAAGGAAGGACAAATAATGAGACAAAACAGAGGTAAAAGTTTTTCCTGAACTTCTACCAGCTTCTTTGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGAATGGCCAGATAGGGTAAAATATGAATTAACTAATGCTTAGCAAATGTTGTATGTCTTAAGCTTTTCAGTTTGTTAGATGAACATCTGTAAATTAATTTAAAAAATATTTAAAATAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40677
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Essential Splice Site 698 2995 8 38
ENSDART00000133507 Essential Splice Site 698 2995 8 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22815170)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19070616
GRCz11 6 21130838
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATGTTTGATTATTATTTACTGTGCATCTTGTTCCTGCTTGTATGGTAC[A/G]GAAGAGCTCATTTGCACAGCTAATCTTCTGGTGATTCCATCTAAGGAGCC
Long Flanking Sequence:
TTGAACCCAACTGCATTTGCTCTTGACATTGTACACGAATGTTGATGTTAAATAGTTCTATTTTGAGCTACAGCATGAACTTTACATGATATACAGGCCTGTAACTGTTATTGTCTGCCTGGCAGCTCCTGCTGAGTCATTGCTGATAATCACCAGACCAATGCAGGATGTGAAGGTCAAGGCAGGAGAGACAGCCTTGCTTGAATGTTTCATCGCTGGGTCACAAGCTGTGGATGTTGATTGGTTAGCCAATGGGAAGTTGATACAGCCAGCACTGTTTGATTGCAAGATGCAGTTTGATGGACACCGATGCCGTCTTCTGTTCAAATCAGCACACGAAAATGACAGTGGATGCTATACTTGCAAACTTAGCACAGCAAAAGGTAGGAGTCAGCACAGCGGGCATCATTTGTGCATAGCATTGTTTGCAAGTAATAGTTTTTATTTCTAATATGTTTGATTATTATTTACTGTGCATCTTGTTCCTGCTTGTATGGTAC[A/G]GAAGAGCTCATTTGCACAGCTAATCTTCTGGTGATTCCATCTAAGGAGCCACTCTTTACACGAAAACTAGAAGTACTAGAGGCGATTGAGGGCCGATCTGCACAATTTGATTGTAAAGTCAGTGGATGTCCTCCTCCTGAAGTCACCTGGACTCACTGTGGTAAAAAAATTATTGAATCAATAAATAAATCAAATCTATTATTTAAGACAATAAATAAAATCAATAAAGTTCAAGAGTAATTTTTTAAGATACCTATTTTGTGTCATAGAAAAACCTCTGGTGGAAAGTGATAATATTCACATACTTAATGTGAATGGGCATCACTCTCTGCTAATCACTCATGTTAACAAGGAGAGTGAGGGACTTTACACAGCAATTGCTCAAAATGTTCATGGAAAAGCAGCGAGCTCAGCTGAACTCTACGTACAAGAACCACGACCGGCCATTTCTACACACATGTAAGAAGACAAGCCCTTGTATTATTGTCAAATTCATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40678
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Nonsense 807 2995 9 38
ENSDART00000133507 Nonsense 807 2995 9 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22815607)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19071053
GRCz11 6 21131275
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTCATGGAAAAGCAGCGAGCTCAGCTGAACTCTACGTACAAGAACCA[C/T]GACCGGCCATTTCTACACACATGTAAGAAGACAAGCCCTTGTATTATTGT
Long Flanking Sequence:
GTTTTTATTTCTAATATGTTTGATTATTATTTACTGTGCATCTTGTTCCTGCTTGTATGGTACAGAAGAGCTCATTTGCACAGCTAATCTTCTGGTGATTCCATCTAAGGAGCCACTCTTTACACGAAAACTAGAAGTACTAGAGGCGATTGAGGGCCGATCTGCACAATTTGATTGTAAAGTCAGTGGATGTCCTCCTCCTGAAGTCACCTGGACTCACTGTGGTAAAAAAATTATTGAATCAATAAATAAATCAAATCTATTATTTAAGACAATAAATAAAATCAATAAAGTTCAAGAGTAATTTTTTAAGATACCTATTTTGTGTCATAGAAAAACCTCTGGTGGAAAGTGATAATATTCACATACTTAATGTGAATGGGCATCACTCTCTGCTAATCACTCATGTTAACAAGGAGAGTGAGGGACTTTACACAGCAATTGCTCAAAATGTTCATGGAAAAGCAGCGAGCTCAGCTGAACTCTACGTACAAGAACCA[C/T]GACCGGCCATTTCTACACACATGTAAGAAGACAAGCCCTTGTATTATTGTCAAATTCATTAAACATTGTTTGTCTTTCACTCATTTCTTTGTAATTTGTACTCTTCAGGTCAAGGTTAGAGAAGATGCCATCAATCCCCGAGGAGCCTGAGGTCCCTGAGGGAGAGGTGGAACGCAGGACAATGCCAGACTTCATAAAACCTCTCAGTGACCTGGAGGTGATAGAAGGGAAAGAAGCAGTTTTGAAGTGCAGGGTGACTGGTCTGCCTTACCCAAAAATCACCTGGTACCACAATGGCAAGAAAATAGAGAGCACTAATGACAGAAAGATGACACAATGTAAGTCCACCAAAATATTGCTAGAAGCATTTTAAAGGGTGTTTGCAGTCCATCTTTGCTCTACAGGTGTGGTCTCGTTAACACTTTAAATTACAGTCCACAAATCACACATTAAGTAAAATTAACAATATAACACAGTTAGCACTGCTAGTCATTGTGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40679
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Nonsense 910 2995 11 38
ENSDART00000133507 Nonsense 910 2995 11 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22819826)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19075272
GRCz11 6 21135494
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCACAGTCTGGTCATTCAATCTGTTTGCCATGACCACAGTGGTGTGTA[T/G]AAATGTGTCATCTCCAACAAGGTGGGGAAGGCTGCCTGCTATGCTCATTT
Long Flanking Sequence:
GCCCCTTTAAGCTATAAATTGTTTCGATAGTCTACAGAACAAACCCTCGTTTTATGATAACATCCCTAATTACCCCAACCTGCTTAGTTAACCTAATTAACCTAGTTAAGCCTGTAACTTTCAGCTGTATAGAAGTGTCTTGAAAAATATCTAGTAAAATATTATTTACTGTCATCATGTCAAATATAAAATAAACCAACTTAAAAATTCTACTGTAATCCATGTGAGATAATTGCATGCACTGCTTAAATTTGCACCCATCTAACTTTGCGTGGATTGTGTGGATTAATGTTGAAAGACCTGGATTTCTCAAAGAAACAGGAAATTTAATCACACTTTCTTGGGATTTCTTGGGATTCTAAATATGAGATTTGTGTACTTCATATTTTGTCTTGTAAATACATATTGTTGTCAGTCATATGCTACCAAGTATCTCTTTTAGACAGGGATGTTCACAGTCTGGTCATTCAATCTGTTTGCCATGACCACAGTGGTGTGTA[T/G]AAATGTGTCATCTCCAACAAGGTGGGGAAGGCTGCCTGCTATGCTCATTTATATGTTGCAGGTAAGATGGAACCTTCTATTATATTTGGGGGTGGTGTATTCGATGCATGTGCCTTACTCACATTATACCTACTTGACAGTTAGCCTTCCTGAGCCACCTGATGGTCCTCCAGTTATTGAGTCTGTAACTGGGAGAATGATCTTATTGAGTTGGAAAAAGCCAAAAAACCTGGACCCATCCATAGGTAATATTTTCTCTGTCTTTTTTTAACTGCCTGTGCATTATATGTCCTGATATTTTATTAGATTATCAGGAATTGACATCTTGGGAAGAGTTGCCATTTTACCATCAAATCTTTTTTGTTTTATTTGTATTTTCAGTCATGATTAATTGCATTAAGATATTGGTAACACTGCATCAGGCATGTACAAACATAGATTAATTTATGTCAATAGCACATGTACAAATTGCTTATTACACACACAGGGATCAGCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12597
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Nonsense 1003 2995 13 38
ENSDART00000133507 Nonsense 1003 2995 13 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22822536)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19077982
GRCz11 6 21138204
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATTGCCTCCAGCCTCACAGACACCTCTTATACAGTCACCTCACTGTCT[A/T]AAGGAGTGTGCTATTCCTTCAGAGTCCTTAGTACAACTGGAAAAACACTA
Long Flanking Sequence:
GGTTGCTGCTTCTCCTGGTTTTCAGGTGGATTTTCTCTGGGTGCTCTCGTTTTTCCCCAGTCCAAAGACATGTGGAGGTTAATTGGGTAAACAAAATTGGCTGAAGTATGTGTGAATAAGGGAGTGTATGGGCTGATTTTTCAGTGCTGGGTTGCAACTGGATGGGCATACGTCACATAAAACTAATGAAAAAAACTTATGATAGAATAATTGGTGGTGTGTTCTGCTGTTGCAAACCTCATAAACTGGGTGTACTAAGGCAAAGAATAGACAGTGTGTGGTATTATTATACATGTTTGGCCATATTAATTTTTTTTAAATTTAAGCTTTTTTAAAAGGTTCTACTGTTTAGACTGTTTCACTCTTTAGCATCTTCTTTGTTAATTTCAGATCCCGCTTCACTGATGTATGTTGTTCAACAGCAAGTTCTGGGCTCCACCCAGTGGACAACCATTGCCTCCAGCCTCACAGACACCTCTTATACAGTCACCTCACTGTCT[A/T]AAGGAGTGTGCTATTCCTTCAGAGTCCTTAGTACAACTGGAAAAACACTAAGCAAACCATCACAACCAACTGATCTGGTCCAGCTCGTTGACAGAGGTATAGATTTGTGGGTAAAAAAATAGATATGTTACATTTTGATGAAACATCTTCTAATATATTGCAGAATTATTAATTAATGAATGCAGTTTTAATTAATGCAGTTCTCTTAGATATAGCTTTACTTAATTTTGGATTATTTTAGTGAAAATGTAACTTGCTTGTGAAATGCTGTATTTGTCATTGCCTGATAAATATATATTTTTTCCTTTATCACAGGAGAGTATTTTCGCAAAGCTCCAGTCATCATTGATAAGCCTGATATCGTGTACGCAGTTGAGAACCAGCCTGTAACCATTACAATTACAATTAATCATGTTCAAGCAACATGTACATGGAAAAGGTTAGTGGTAAAACAAGCCAGACATTGAAAGTACAATATGAATTATAAATATTAAGGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14625
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Essential Splice Site 1134 2995 16 38
ENSDART00000133507 Essential Splice Site 1134 2995 16 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22824843)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19080289
GRCz11 6 21140511
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAAAGAGAGCATTATTTTTGGTAGTAAAGNTTTTTCTGTTGGCCATTTC[A/C]GTGCCCCCTATATTTGAAACCATCATGGAGGACTTGGATGTGTGTGTTGG
Long Flanking Sequence:
GCCCAGATATTAGCACTCTTGCCTCACAGCAAGAATGTCACTGGTTCTAGTCCTTACCAAGTCAGCAGACATTTCTGTGCAGAGTTTATACGCTCTCCCCATGCTCACGTGGGTTATCCCCACATAAGTTAATTGACTAATCCAAATCGACACCATAGACATGCTCCTAGTAAGTAGTTATCTCTTAAAAGCAATCTCTATATGTTCATTAGCTACTACAGCAGGAGAGTTCTCGAGATCTACCTGAGCTCAAACTCCCCTCTCGCCTTTCAAACGGGAGCGAGCCCGTGCTCGAGGATCTTAAAGCCAAACAAGCTTTATAATGAATCATCAGCTAAGTGTGAACTCTTGAAATATATTGTAAATAACTATATAACCATTGATTTCTGGAGGCAGCTGTTCCTTACTTTCCATTCTTTATATTGAGTTTTTCTTTTTCATTAAATGTGCTTAAAGAGAGCATTATTTTTGGTAGTAAAGTTTTTTCTGTTGGCCATTTC[A/C]GTGCCCCCTATATTTGAAACCATCATGGAGGACTTGGATGTGTGTGTTGGGGAAACATGTCATTTTGCTGTGGTTGTGGATGGAAAACCCGACCCTGATATCCTCTGGTACAAGGTCAGTATTCACTGACACACAGATTTTTTAAAGAACTGATTTAAAGATTATCATGCTACTGTAATTGACCTCATCCATGTGGGGCCCAGATGAGTTACCCTTGGACTGATATCTGGGGCTCTCCTGGGCTAGCCAACTGGGACAAATTTTGTTCTCGGTTTCATGATGGCCCCACGTGTCAGCCTAAGTGAATAATCATGGGTCTTTAATAGGCTCCATATGAGATGCCCACCTTAATTTACCCATGTGGGTTCTAACGGGGCTACCAAGGTGGGCCCCACATTGTCAGGGTTCTGCCACTCGGGCCTTGTGAATTCTTGTTTTGGTGGCAGAGTCCGAAGACTAGCTATGTCTTGTCCTTTTTCTGTCATTGTGTGTGTCTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40680
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Essential Splice Site 1171 2995 16 38
ENSDART00000133507 Essential Splice Site 1171 2995 16 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22824959)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19080405
GRCz11 6 21140627
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGTGGTTGTGGATGGAAAACCCGACCCTGATATCCTCTGGTACAAGG[T/G]CAGTATTCACTGACACACAGATTTTTTAAAGAACTGATTTAAAGATTATC
Long Flanking Sequence:
TCCCCACATAAGTTAATTGACTAATCCAAATCGACACCATAGACATGCTCCTAGTAAGTAGTTATCTCTTAAAAGCAATCTCTATATGTTCATTAGCTACTACAGCAGGAGAGTTCTCGAGATCTACCTGAGCTCAAACTCCCCTCTCGCCTTTCAAACGGGAGCGAGCCCGTGCTCGAGGATCTTAAAGCCAAACAAGCTTTATAATGAATCATCAGCTAAGTGTGAACTCTTGAAATATATTGTAAATAACTATATAACCATTGATTTCTGGAGGCAGCTGTTCCTTACTTTCCATTCTTTATATTGAGTTTTTCTTTTTCATTAAATGTGCTTAAAGAGAGCATTATTTTTGGTAGTAAAGTTTTTTCTGTTGGCCATTTCAGTGCCCCCTATATTTGAAACCATCATGGAGGACTTGGATGTGTGTGTTGGGGAAACATGTCATTTTGCTGTGGTTGTGGATGGAAAACCCGACCCTGATATCCTCTGGTACAAGG[T/G]CAGTATTCACTGACACACAGATTTTTTAAAGAACTGATTTAAAGATTATCATGCTACTGTAATTGACCTCATCCATGTGGGGCCCAGATGAGTTACCCTTGGACTGATATCTGGGGCTCTCCTGGGCTAGCCAACTGGGACAAATTTTGTTCTCGGTTTCATGATGGCCCCACGTGTCAGCCTAAGTGAATAATCATGGGTCTTTAATAGGCTCCATATGAGATGCCCACCTTAATTTACCCATGTGGGTTCTAACGGGGCTACCAAGGTGGGCCCCACATTGTCAGGGTTCTGCCACTCGGGCCTTGTGAATTCTTGTTTTGGTGGCAGAGTCCGAAGACTAGCTATGTCTTGTCCTTTTTCTGTCATTGTGTGTGTCTCTGTGTGTGCCGTCGGGGGTGTGCGCAGGGCTTGATGCGGCCGCACAGGCTCTGCGTGTCTCGGACGCGCGCGCTCTTGTACTCGTGTTTGTGTTTTCATCTGTCTGCAGCGTGGCGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3585
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Essential Splice Site 1329 2995 19 38
ENSDART00000133507 Essential Splice Site 1329 2995 19 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22828032)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19083478
GRCz11 6 21143700
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCCATGATGCTTTTGAGAAGAGGCGTGTAGTGATCATTCTTACCGAACT[G/A]TATCCTTGAACCAGCATATATTCTTTCTAAATGCTCATTCTTTCTAAATG
Long Flanking Sequence:
TAAACAAATTCATTATTACTTAGATGGTTTAACCAACAGTAGTATTAAAAAACTCAGTAAAACAAGTTTATTTAGTAGGCTGTGTAATGTGTGTGTTTATACTTACTATCATAGCCCAAAATGTGGAGGAAGAGGAAGAGCAAATGGAAGATGAAGCCACAATTCTGCGAAGGATGCGTATGCTGACTGATTACTATGATATACACAAAGAGATTGGCAGGTCAAATGCCGTTTCTTAGAGCATTCCTTCAGTTTATTGATTGTATTTTAATCTGACAGGTCTGTAATGTCTTTGTTCACAGAGGGGCTTTTTCATATGTCAAGCGAGTGAAACACAAAAATGACCAATCTTTTGCAGCAAAATTTATTTCAGTGCGGGCAAAGAAAAAGACTTGTGCATTGCGAGAGTTGGCACTTCTGGCAGAGTTAGACCATAAGAGCATTGTCCGCTTCCATGATGCTTTTGAGAAGAGGCGTGTAGTGATCATTCTTACCGAACT[G/A]TATCCTTGAACCAGCATATATTCTTTCTAAATGCTCATTCTTTCTAAATGTCTTTAAAAAAAGTTTGCTGCCATAATTTCCTTAAATGATTACAAAGATGCCATGAAGAGCTATTGGAAAGAATAACAAAAAGAACAACAATCTTGGAATCTGAGGTTGGTGTTTTAACTGTGTATCAAGTTGGAATTCATTATTTCTGCATGTTGTTTAAACAAAGTCAGAGAACTACTGGCTAATCAAATAATCCACTGAATTGTATGTGCAGGTTCAGTCTATTATACGGCAGCTACTTGAGGGAATCGAGTATCTTCACCAGAATTACATAATTCACCTTGATTTAAAGGTCAGTCATGAACTAGCTGATTCACAAAATCAAAACAAATGGCTGTTTTTGACTTTTAAGAAACAAGTAATTATAACATGTGTGTATTTCAGCCTGAAAACATCTTAATGGCAGACCAAAAAACTGATCAGATTCGTATTTGTGATTTCGGCAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7040
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Essential Splice Site 1441 2995 23 38
ENSDART00000133507 Essential Splice Site 1441 2995 23 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22828751)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19084197
GRCz11 6 21144419
KASP Assay ID:
554-4687.1 (used for ordering genotyping assays)
KASP Sequence:
AAAACTATCCTTCTCTTTGCAGGCCAGTTGGTGTCATAACRTATTTATGG[T/C]ATGTTTATAATGTCCACTAGCAAATTTGAAATTAGTGCTACATTTAAATK
Long Flanking Sequence:
CAGAGAACTACTGGCTAATCAAATAATCCACTGAATTGTATGTGCAGGTTCAGTCTATTATACGGCAGCTACTTGAGGGAATCGAGTATCTTCACCAGAATTACATAATTCACCTTGATTTAAAGGTCAGTCATGAACTAGCTGATTCACAAAATCAAAACAAATGGCTGTTTTTGACTTTTAAGAAACAAGTAATTATAACATGTGTGTATTTCAGCCTGAAAACATCTTAATGGCAGACCAAAAAACTGATCAGATTCGTATTTGTGATTTCGGCAATGCTCTGAAAGTCAAACCAAATGAAGAACTGTACTGCAAATATGGTACACCAGAATTTATTGCTCCAGAGATTGTAAACCAGTCACCTATCTCTAAATCTACAGACATTTGGTAATAGAGCACACATTTATCTACCATTTGATAAATATTGTTTCATTCTCTGTATTTTCTAAAACTATCCTTCTCTTTGCAGGCCAGTTGGTGTCATAACATATTTATGG[T/C]ATGTTTATAATGTCCACTAGCAAATTTGAAATTAGTGCTACATTTAAATTAATTTACCATGACTTTATAATGTGTTCAATTTACAGCCTCACTGGAGTGTCTCCGTTTGCTGGGGAAAATGACCGTGACACTCTGCTGAACATCAGGAACTATAATGTTGCATTTGAAGAAAGCATGTTCAAAGATCTTTGCAGAGAAGCAAAAGGATTCATTATAAAGGTTCTTGTTTCAAACAAACTGTAAGTGTTTATCATGCCATATTCTTTGAGTTATTGACTATCAATCCGATTGGTTGGCATAGAGTATTAAATTATGGTCAAACATTTGTACAGGAGACCCGATGCCACAGAGTGTCTTCTTCATCCATGGTTCAAGGTACAATAAAAAATACAGGCTGTTTATGATGTTTAAAACAGTAACATATTCACAAATATTCACACAAATGAAGGTGCAGTCTGTAAGTTTGACAACCAGAGGTTGAACTAAGTATTGCATTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40681
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Essential Splice Site 1506 2995 None 38
ENSDART00000133507 Essential Splice Site 1505 2995 None 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22829128)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19084574
GRCz11 6 21144796
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTACAGGAGACCCGATGCCACAGAGTGTCTTCTTCATCCATGGTTCAAGG[T/C]ACAATAAAAAATACAGGCTGTTTATGATGTTTAAAACAGTAACATATTCA
Long Flanking Sequence:
CTACAGACATTTGGTAATAGAGCACACATTTATCTACCATTTGATAAATATTGTTTCATTCTCTGTATTTTCTAAAACTATCCTTCTCTTTGCAGGCCAGTTGGTGTCATAACATATTTATGGTATGTTTATAATGTCCACTAGCAAATTTGAAATTAGTGCTACATTTAAATTAATTTACCATGACTTTATAATGTGTTCAATTTACAGCCTCACTGGAGTGTCTCCGTTTGCTGGGGAAAATGACCGTGACACTCTGCTGAACATCAGGAACTATAATGTTGCATTTGAAGAAAGCATGTTCAAAGATCTTTGCAGAGAAGCAAAAGGATTCATTATAAAGGTTCTTGTTTCAAACAAACTGTAAGTGTTTATCATGCCATATTCTTTGAGTTATTGACTATCAATCCGATTGGTTGGCATAGAGTATTAAATTATGGTCAAACATTTGTACAGGAGACCCGATGCCACAGAGTGTCTTCTTCATCCATGGTTCAAGG[T/C]ACAATAAAAAATACAGGCTGTTTATGATGTTTAAAACAGTAACATATTCACAAATATTCACACAAATGAAGGTGCAGTCTGTAAGTTTGACAACCAGAGGTTGAACTAAGTATTGCATTCCTGGATCAAAACAAATGCAAGCACAGGTTGCCAGATTGAGAACCAACAGGAGCGAGTCTGACGATTAAACCTAAAGGCTGATTTAAATCATGTTCTAAATAAAAGCAACAGTGTGCAATAGAAGGAATCTTCTCCATATTAAAATGAGTTTTTGTTCTAACCAACAACTTAAATTCACATATTAGAAACAGCTTCTATTTCTTGTATGAACCCAAAAAAACTGACAATGATCACCTCAGGTACATCTCATGTGCTTTAAATGCTAATAATGTGAGTTTGAATATGATTTTACATGACATTTATTGCCATACTACTGAAAGCAGCAGCAGTTTACCTCAGATCTTGAAAATAAAACAAACCATTTGAAATTGATCTTTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40682
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Nonsense 1546 2995 27 38
ENSDART00000133507 Nonsense 1545 2995 27 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22830585)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19086031
GRCz11 6 21146253
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGTTCACTCATTAGATATGGGTCTAAAATGGTTATGAGGTCCATATCC[G/T]AACTGCTGGATGACTCCTCTAGCCATGTATCTCTTGCTGTGCCTAGAAAC
Long Flanking Sequence:
GTTCCGGACATAAAGACATTTTTAAAAGCAGAATAACTGACTTTAGCATTGTATTTTTAAGCAATAAAAGAATGTTCACCTGGCATGTTTCTTAAATATCAGCAAACAAATTCTGTTTTTTTTTAATTAGAAGAGTCAAAAACTTACATATAGTACATTTAAGTTTAAGTTCAATCTATGTGTGTAAAATACACAGTATGGCTAGAGTGAAACACAACACAATTATGAGCACCGAGATGTTTCTGTTTTACAACACAATATTCTTACTTTTTTTTTTTCCATTTCAGTCATTAACAAAGGGGAAGTCTATCAACACAACACTGCATAAGCAAGTGCTAGCCAGACGGAAGTGGCAGGTAAACCATTTATTAAGTATAATAAATAAATATTAATCAAAGATAAATAAAAGGACATTGATTACTAATAAAATGTGTTTATTTTGTCTATTTCAGTGTTCACTCATTAGATATGGGTCTAAAATGGTTATGAGGTCCATATCC[G/T]AACTGCTGGATGACTCCTCTAGCCATGTATCTCTTGCTGTGCCTAGAAACCTTAAAGATGGCTCGCCACCTCCATCATCATCTTCTGACTCAGATGAAGACATTGATGAACTTCCTTTCATCCCTATGCCCCACACAATGATGTTCTCTGGTTCCCGGATGTCTCTGACTGAGATCCATGAGGATGATGATAAAGTCATTAGAGGATCCAATGAATCCTACAAAAAGAACTTGAATCAACTTGATGACATCCCAGAATCCCAAATAATCGCTGGACAGAAGAATGAAGACTACCTGAAAAATCCAAAAAGGACTGATAACTGTTTGCAAAGAGGTTCCAGTGTAGAAGTTGATCAGGTTGCAAGCAAGACCAGAAGAGGGCTAATGCGAAGAGGGAGTTCTGCTGATAGTGCACTTCTTCTGCAAATAACACCTGAAGATAATGAAATAAAGGATACTACAGAGGATAGCCAAAAGCACATGAAAAAGGCAGTTTCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7581
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Missense 1894 2995 27 38
ENSDART00000133507 Missense 1893 2995 27 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22831630)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19087076
GRCz11 6 21147298
KASP Assay ID:
554-4105.1 (used for ordering genotyping assays)
KASP Sequence:
ACAGGTGTCTAAGGAAGAGGCTAATAGTGATGTCTTGATTATGMATAGCT[C/T]TCGGTCTGCATTTAATTTAGAARACACTGAAATTATGGTAGAAGAGATGA
Long Flanking Sequence:
CAAGGAAGATTATGCTTTGAAACTGGATCTTATGAGGCAGAGGTTGCTAAAAGGAGGCACTGTTAACAAGAATATGAGTGGTCTTCGTGGTCCCCTACTGGAGACACTGGGTGTAGACGATGAGAGGAGAACTTCCTCTTTGGATCGTAACTTCAGAAATGCAAGGTTGAATGCTTCAGGAGATTCTGGGACATTTAACAATGACAGCTCTGAAGAAACTTACCAAAAACCTGCATTCAGGAAGAGGTCTTCTTTAAGAGACGAAAACTCAGAGTCAATTTCTCTTCATAGGAGATCTGGAGCCCCACTTGAGATTCCCTCAAGTTCTACTGGAGATCATAATGTGCTGAAAATTAAATCGACCATCCTGGATGAAAACAAGGCTAACCTGCCACCTTTGTTTCCAAGAGACATTTCTTCGAAGCCACCAACTCCAGTTTTAAAAAATAAACAGGTGTCTAAGGAAGAGGCTAATAGTGATGTCTTGATTATGCATAGCT[C/T]TCGGTCTGCATTTAATTTAGAAGACACTGAAATTATGGTAGAAGAGATGAAAGAACAAGACAGTGTTCCGGAAAATATGAATAAAAGTACTGAATTTCCTCTTGATATACTCCCACATGATATATCATCAAATTATTGCAGTAAATTGCAAGCAAATGGTAAAAAGGCATCATTTCTCACACCATTACCGACACCAGTTTTAAAAATCTCCCAGCCCAATATTCAACCTACCGCTGGGCGACCAGGTGTTTTTGCTTCTGCTTTTTCTGCACACCAGCCAAATCTTAGAAGTGATATCAAAAATATTGATTCAGAGGAAATTTTTGAAGCTAGATTTAAGAAAAGGGAATCATCTTTGGCACATGGTCTAAAACGATTGACAAGGACAAAGTCTGAAGAAAGCTCACCGGTTCCCCAACGGAAATCAGATGAAGTGGTCTATCGACCTGGACCTGTAGGTTCCCCATTGGAGTTTGGATCAACAGGATTAAAGGAAAAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5365
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Nonsense 2108 2995 27 38
ENSDART00000133507 Nonsense 2107 2995 27 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22832271)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19087717
GRCz11 6 21147939
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATTGACAAAAAAGAGAAAAAGGAGATCTCMGATTCTGTAACTAACAAA[C/T]GACAGCTTACCTGGGCTACGAGACGTAGCAAGTCCCTAGACAAAAAAGAA
Long Flanking Sequence:
GTAAATTGCAAGCAAATGGTAAAAAGGCATCATTTCTCACACCATTACCGACACCAGTTTTAAAAATCTCCCAGCCCAATATTCAACCTACCGCTGGGCGACCAGGTGTTTTTGCTTCTGCTTTTTCTGCACACCAGCCAAATCTTAGAAGTGATATCAAAAATATTGATTCAGAGGAAATTTTTGAAGCTAGATTTAAGAAAAGGGAATCATCTTTGGCACATGGTCTAAAACGATTGACAAGGACAAAGTCTGAAGAAAGCTCACCGGTTCCCCAACGGAAATCAGATGAAGTGGTCTATCGACCTGGACCTGTAGGTTCCCCATTGGAGTTTGGATCAACAGGATTAAAGGAAAAATCCAAGTCTGTCCAAGATCTTAGGGAGGTAGATAAAGAAATTGGGCTTGGACTTATTGGAAGATTCTCCATGCGTGCAAGGAAATTGCAACCCATTGACAAAAAAGAGAAAAAGGAGATCTCAGATTCTGTAACTAACAAA[C/T]GACAGCTTACCTGGGCTACGAGACGTAGCAAGTCCCTAGACAAAAAAGAAAACTTTGAAACAAACAAAGAAAATCTTGAAAAGGATACTAAAAAGATTGCTGAATCACCTGTCCTTGCAGTGCGACGTAAATTTGAATCTAATGTTTCAGGAATATTTGATAGAGTGCATAGCAGGTCAAAAGACAGAAAGGATAAGGAAACTAAACCCCACATTGATGCAGAAGCATCAAACGTTGAGAAACAAGATATGAAGAAAATAAATGATTCACCAGTTCTGGCATTGCGAAAAAAATTTGAGACAAAGGTTTCAGGATTTTCATTAAGAAAGCAAAGTCAGTCTGAGGGAGAAGGAACAAAATTTGAAGGACAGAAAACACCTTTATTTTCCCGTCATCATCGTTCCCAGTCTGATGGGCTCATTCACAAGAAAATGGATATTCCAGAGAACCAGCTTCCCTTGCAAACTACTACTATATCATCTAAAGAGACACTTAATTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9635
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Essential Splice Site 2844 2995 35 38
ENSDART00000133507 Essential Splice Site 2843 2995 35 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22836190)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19091636
GRCz11 6 21151858
KASP Assay ID:
2259-7493.1 (used for ordering genotyping assays)
KASP Sequence:
TCTGTCCCTCCAACAATGCAGCAGATATCTGGGAACTCTGGAATACATGG[G/A]TATGCACATACAATTTCTATGTTTTTCTASTAAAATTATTTAAAACATAT
Long Flanking Sequence:
AAGATAATACCCTATGATCAGAAAACCAAGCAAACCATTATAAAGGAATATGAGATTTTGAAGTCCCTTCGATGTGAAAGAATCATGGCCCTACATGAAGCTTATATCACACCACGCTACCTTGTACTCATAACAGAATATTGCTCAGGCAAGGAAATCCTGCAAAATCTAATTGACAGGTGTGTATGAGCCTTTCTTTGTGTGTGTGTGTTCAAGGACTTTGATAGCTGAACTGTGAAATTTAAGTCTTGACATCAATGGTATTTTCTCTTACAGATTCTGTTATTCTGAAGATGATGTAGTGGGTTTTATAGTCCAGATCCTTCAAGGTTTGGAATATCTCCACAACTGCAAAATTCTTCATCTGGACATTAAACCAGACAACATCATGGTCACCAACCTCAATGTAATTAAGATAATAGATTTTGGCAGTGCTCAAAGGTTTAACCCTCTGTCCCTCCAACAATGCAGCAGATATCTGGGAACTCTGGAATACATGG[G/A]TATGCACATACAATTTCTATGTTTTTCTACTAAAATTATTTAAAACATATTCATGCCATGCTGGTGTTAATGTTTTTTTCTGTCCTTTTTAAGCTCCTGAAATGCTGAAAGGAGATCTTGTTGGACCCCCAGCAGACATCTGGAGCTTGGGAGTTCTATCTTATATTATGTTAGTTTAGTCTATTTACAATTAAACACAACAGGACAGATTATGTTGATCCTAGAGCATAAGTCATGTTTAAAAATGTAATCCACATTCCAAATCCCCACCACTAAACCTAACTCTAACTGCCAATTATTCCCAAAATTACAAGGTGTTAATTGTTGGATAACAATGATGTAGAAGCACATAACCCTAAAGGCTGATTTATACTTCTGCATCAAACGGCGGCGTATGCTACGGCGTTGACGCATAGCTCTTCGCCGTGGCCGTCGGCGTCACTGACGTGCACCTCACAAAAAATGTAACTACACGTCGCAACAACGTGTAGCGCAAGCTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa624
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Essential Splice Site 2845 2995 36 38
ENSDART00000133507 Essential Splice Site 2844 2995 36 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22836283)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19091729
GRCz11 6 21151951
KASP Assay ID:
554-0534.1 (used for ordering genotyping assays)
KASP Sequence:
AAACATATTCATGCCATGCTGGTGTTAATGTTTTTTTCTGTCCTTTTTAA[G/T]CTCCTGAAATGCTGAAAGGAGATCTTGTTGGACCCCCAGCAGACATCTGG
Long Flanking Sequence:
CATGAAGCTTATATCACACCACGCTACCTTGTACTCATAACAGAATATTGCTCAGGCAAGGAAATCCTGCAAAATCTAATTGACAGGTGTGTATGAGCCTTTCTTTGTGTGTGTGTGTTCAAGGACTTTGATAGCTGAACTGTGAAATTTAAGTCTTGACATCAATGGTATTTTCTCTTACAGATTCTGTTATTCTGAAGATGATGTAGTGGGTTTTATAGTCCAGATCCTTCAAGGTTTGGAATATCTCCACAACTGCAAAATTCTTCATCTGGACATTAAACCAGACAACATCATGGTCACCAACCTCAATGTAATTAAGATAATAGATTTTGGCAGTGCTCAAAGGTTTAACCCTCTGTCCCTCCAACAATGCAGCAGATATCTGGGAACTCTGGAATACATGGGTATGCACATACAATTTCTATGTTTTTCTACTAAAATTATTTAAAACATATTCATGCCATGCTGGTGTTAATGTTTTTTTCTGTCCTTTTTAA[G/T]CTCCTGAAATGCTGAAAGGAGATCTTGTTGGACCCCCAGCAGACATCTGGAGCTTGGGAGTTCTATCTTATATTATGTTAGTTTAGTCTATTTACAATTAAACACAACAGGACAGATTATGTTGATCCTAGAGCATAAGTCATGTTTAAAAATGTAATCCACATTCCAAATCCCCACCACTAAACCTAACTCTAACTGCCAATTATTCCCAAAATTACAAGGTGTTAATTGTTGGATAACAATGATGTAGAAGCACATAACCCTAAAGGCTGATTTATACTTCTGCATCAAACGGCGGCGTATGCTACGGCGTTGACGCATAGCTCTTCGCCGTGGCCGTCGGCGTCACTGACGTGCACCTCACAAAAAATGTAACTACACGTCGCAACAACGTGTAGCGCAAGCTTTGTTATTGGTTGGCTTGGTAGCGCTGACGAGTCTGGGCGGGACCGAGAGCCGCGCGAGCAGCGCTAGCCCAATGGAGCGATTGTTTACTAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45251
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029697 Nonsense 2944 2995 38 38
ENSDART00000133507 Nonsense 2944 2995 38 38
ENSDART00000137461 None None 164 None 4
Genomic Location (Zv9):
Chromosome 6 (position 22839369)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 19094815
GRCz11 6 21155037
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGCCTCATTCATTCATGGCTTCATGACTCATATCTGAAAAAGCTGCGT[C/T]GACAGACCTTGACTTTTACTACCACTCGTCTCAAAGAATTCATGGGTGAG
Long Flanking Sequence:
TATACAACAGCATGCATTTTAAAATTCCTAAATGTTTTGTTAGTATTTATGAGTATTTAAATGGCAAGCACACCATGCCTCTTTTTATGCTCCACAGCGGAGTATAAGATTTGAATTAAGCAGTGATTACGTGTGTTGAGGACATTCAAATCACACCGGTGTGATTATTTTTACAAAGGCTTAAAACTCAGCTGGAAGTTTTTTTTCAGTCAGAGCTACACACTGCATGAAAGGTCATTTTGAAAAATCAACAATGCAGACACTTTAAGCAATATTATTTTAATATTATTTCAAGCACAGAGTTTTAGCTATATGAAAATAAAGGTGAACTGAACATTTATATAGAATAAGTTTGATTTCTTTACAGAGAGTAATGAGGTGAACACTTTGAACCCAATAACTTGATTGATTTCATGTACTTTTTCTTCAGGTGCCGGCCTACTATTAAGGACTGCCTCATTCATTCATGGCTTCATGACTCATATCTGAAAAAGCTGCGT[C/T]GACAGACCTTGACTTTTACTACCACTCGTCTCAAAGAATTCATGGGTGAGCACCAGCGCAGATGTGCAGAGTCTGCTACTAAACATAAGGTTATTCTTCGAGTCTACCAGGGTGGACCTTCATCTCCAGCCTCACCTACCAAGTACACCACTCAGTGAACAGATAAAAGGACTTTCAATAGAATTGGGACATGGACTCTATATATATATAAACTCTTTCAGAGTGGGAAAAAAATCTGGAAAGTCTTGTTGACATTAATAATATGAGTATTTTCGACTTGACACTTTCTCACAAAAAAAGTAGTTGATGGTTGATAACAGTTTTTCCAGGGTGTGAGACATTACATTAAGAGCAATAAAGGATTAAAATAACTTTGGAACAGTGTTTTTAGATGACAATGATGATGATGATGATGATTTTAATGAAAGAGGTATGATATTATTTTGTGCACATTTGTGCAGTTACTGCTAATGAATCAACTTGAACACAGAAGATGTTAT
Associated Phenotype:
Not determined