Busch Lab

ZMP

FAM179B

Ensembl ID:
ENSDARG00000039197
Description:
family with sequence similarity 179, member B [Source:HGNC Symbol;Acc:19959]
Human Orthologue:
FAM179B
Human Description:
family with sequence similarity 179, member B [Source:HGNC Symbol;Acc:19959]
Mouse Orthologue:
Fam179b
Mouse Description:
family with sequence similarity 179, member B Gene [Source:MGI Symbol;Acc:MGI:2684313]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa38189 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30536
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057266 Essential Splice Site 80 578 4 13
Genomic Location (Zv9):
Chromosome Zv9_NA429 (position 51993)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 624678
GRCz11 17 632040
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTGC[A/G]GACGTGTCACAGCAGGATCAGTGTGTGTGTGAGAGCAGTGTGAGTGTGGT
Long Flanking Sequence:
GTGTACTTAAACACCTTTGCTTGTAAATGTACATTTGCACATGTGTAAAAGTTGGCATGCATGCATGTTTGTGTTTGTGAGTGTGTGTTTGGTTCTGATAATAATTTCATTATGGTGACCAAATGTCCCCACAAGTATAGCAAAACCAGTCATTTTAGAGCTTGTGTGTTCATTCTCTTTGGTCTTTGGGTTGAGTTTAGTGCGGGGGTGTCCAAACTGCCGGTGTCCTGCAGATTTTAGCTCCAGCTTGCCTCAACACACCTGCACTGATGTTTCTAGAAAGCCCAGTAAGAGCTTGATTAGCAGGCCCGGGTATGTCTGATTGGTGTCTGAACTAACCTTTGCAGGACACCGGCGCTCCAGGAGCGAGTTTGAGCCCCACTGGTTTAATGAATATGCAGTCTGTACACTAGAAACATCATTACAGCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTGC[A/G]GACGTGTCACAGCAGGATCAGTGTGTGTGTGAGAGCAGTGTGAGTGTGGTCGGTCAGAGAGTGTGTTTCTCCAGAGCTCTGGATGCAGAAGAGCAGAAGGTCAGCGAGGTCAGCTCGTCTCCTCAGGTCAGAGCTGCAGGACGGGAGCCGCTCCGAGCACTCAGACCCGCTAAAGGTGAAACACACCACAGCTGCTGTTATTATCATTATATAAAGCTGCATCCTCAGCATCATTACTCCAGTCTTCACTATACACCTATATTATTCTGCATTTTAGGATATAACATTAAAACAAACGCTCAGAGCTGTAGTGGGTAAAGTCTTGATCAGTGTCTGTGCTTCAGTGCTGTAGTTTCTGCTGATCACATGATCTGACAGATATCAATGTGTGTGAGGGTCTTTGTGTCAGTAGTGTTGGTCTGCAGATATAAATGTGTGTGTGAGGGTCTTTGTGTCAGTAATGTTGGTCTGCAGGTATAAATGTGTGTGTGAGGGTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38189
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057266 Nonsense 146 578 5 13
Genomic Location (Zv9):
Chromosome Zv9_NA429 (position 54618)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 627303
GRCz11 17 634665
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGTGTTTGTGTGTGTTGTTTTCAGGAGCGCCGCAGCACGTGTCCAAGT[C/A]GTGTGGTCTGCGTGAGATGTCAGAGGGTGTGATTGGACGAGGTGTGTGTT
Long Flanking Sequence:
TGAGGGTCTTTGTGTCATTAATGTTGGTCTGCAGGTATAAATGTGTGTGTGAGGGTCTTTGTGTCATTAATGTTGGTGTGCAGGTATAAATGTGTCTGCGAGGGTCTTTGTGTCAGTAATGTTGGTTTGCCGCTATATATGTGTGTGTGAGGGTCTTTGTGTCATTAGTGTTGGTCTGCAGATATAAATGTGTGTGTGAGGGTCTTTGTGTCAGTAATGTTGGTCTGCAGAAGTAAATGCGTGTGTGAGGGTCTTTATGTCACAGTGTTTCAGTATAGCTCTTCTTCTACTATTATTTCCTCCAAAACTGTCTTGAGCATCTGTCTGTGCTTCTAAAGTTTCCTCTACTGTTGCACGACTCTACGATTATATAAAGCACTACAGAAATGATAGACTGATGCGCAGAACTGAAGTGTTGCATTAAACATCAGTGACTAAAGCAGTGTGTTTTATGTGTTTGTGTGTGTTGTTTTCAGGAGCGCCGCAGCACGTGTCCAAGT[C/A]GTGTGGTCTGCGTGAGATGTCAGAGGGTGTGATTGGACGAGGTGTGTGTTCATGTTTAGATTAGATTCAGCTGTATTGTCTTTACACATGTACTTGTACAAAACCAGGCTCAGTTGGGCACCACCATTTCTCCTCTGACCTAACTGGAGAACGCTGAACCTCCATCATGGAGAAGCTCCAGGAGTGAGCAGGTCACCGGCGGGTGAATCAACGCAAAGACTCGTCTGTCACTAAGGTCTTACAGGAATCAGTCTCATGCTCTCCACTCCTCCATGACCACCTTAGCATCTGCTCAGGATACGGCCTGGTCCAGGATTATGGAAACCTTGGGAATATTAAAAACAGACTAACATAAGTGCAATGGAATGCAGCTCAGGTCTAACCGGGAGTGCAGCATATTAGTGCACTTGCTGTTTTTGCACTTCTGGTTAGACATAAACAGCATTCCATTGCCTTGTATCTGTACATAAGTAATGAGAATATAGTTGAATCTAATCTAG
Associated Phenotype:
Not determined