Busch Lab

ZMP

si:dkey-264l15.1

Ensembl ID:
ENSDARG00000039196
ZFIN ID:
ZDB-GENE-030131-4022
Description:
Novel protein similar to H.sapiens GREB1, GREB1 protein (GREB1) [Source:UniProtKB/TrEMBL;Acc:B8JKP6]
Human Orthologue:
GREB1L
Human Description:
growth regulation by estrogen in breast cancer-like [Source:HGNC Symbol;Acc:31042]
Mouse Orthologue:
Greb1l
Mouse Description:
growth regulation by estrogen in breast cancer-like Gene [Source:MGI Symbol;Acc:MGI:3576497]

Alleles

There are 11 alleles of this gene:

Allele Name Consequence Status Availability
sa17608 Nonsense Available for shipment Available now
sa1657 Nonsense Available for shipment Available now
sa5124 Nonsense F2 line generated Not yet available
sa16374 Nonsense Available for shipment Available now
sa16854 Nonsense Available for shipment Available now
sa19691 Nonsense Available for shipment Available now
sa32856 Nonsense Available for shipment Available now
sa25771 Nonsense Mutation detected in F1 DNA Not yet available
sa14368 Essential Splice Site Available for shipment Available now
sa1260 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17608
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057268 Nonsense 41 1942 1 32
ENSDART00000138562 None None 461 None 8
ENSDART00000144910 None None 256 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 11555600)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11980696
GRCz11 2 11764295
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCATTAAGGTCAAGCGGTGGTGACCCACAGCCGGTTTTCACACAGCTATA[T/A]CTCKAGCCTGATCAGTATTCTGGCCATGTAGAAGGTAAGCAAGGCTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1657
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057268 Nonsense 43 1942 1 32
ENSDART00000138562 None None 461 None 8
ENSDART00000144910 None None 256 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 11555604)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11980700
GRCz11 2 11764299
KASP Assay ID:
554-1604.1 (used for ordering genotyping assays)
KASP Sequence:
TAAGGTCAAGCGGTGGTGACCCACAGCCGGTTTTCACACAGCTATATCTC[G/T]AGCCTGATCAGTATTCTGGCCATGTAGAAGGTAAGCAAGGCTATTTGTCNNNNNNNNC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3425
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057268 Nonsense 297 1942 6 32
ENSDART00000138562 None None 461 None 8
ENSDART00000144910 None None 256 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 11568375)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11993471
GRCz11 2 11777070
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCATCCTCAGGGATTTTTGGACCCCAGGAGCTGGGCTTCCTTAAACCAT[T/A]GAACACACCGACCCACGGGACCAAGACATTACCGATCGGTATCAGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5124
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057268 Nonsense 347 1942 7 32
ENSDART00000138562 None None 461 None 8
ENSDART00000144910 None None 256 None 4
Genomic Location (Zv9):
Chromosome 2 (position 11574840)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 11999936
GRCz11 2 11783535
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTACTGAGCCCACCTCGTACAAACCCACTCTCCACCCCTAGTCATGGCTA[T/G]AGAACCACAGAAACAGGAGACAGTCCAGGTAAGCATTACACTGGCCAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16374
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057268 Nonsense 408 1942 9 32
ENSDART00000138562 None None 461 None 8
ENSDART00000144910 None None 256 None 4
Genomic Location (Zv9):
Chromosome 2 (position 11576891)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12001987
GRCz11 2 11785586
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAATGTTTTGCTCTTTCCTTTCAGGTCCTTTATTGTCMCTGTCCAATCAA[C/T]AGCCTGCATCGGTSTCAGGGGTCATACAACCACAGCCAATCACAGCWGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16854
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057268 Nonsense 543 1942 11 32
ENSDART00000138562 None None 461 None 8
ENSDART00000144910 None None 256 None 4
Genomic Location (Zv9):
Chromosome 2 (position 11580037)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12005133
GRCz11 2 11788732
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTGTGTGGTCCRACTGGCCCTCCAGTGTCGCCTGCGCAGCTGCCCTGGT[T/A]AGCCCGAATGGAGGCCAGTGTGTCAGGGGGCAGTGTTCAGGTGCTGGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19691
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057268 Nonsense 566 1942 11 32
ENSDART00000138562 None None 461 None 8
ENSDART00000144910 None None 256 None 4
Genomic Location (Zv9):
Chromosome 2 (position 11580105)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12005201
GRCz11 2 11788800
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTGTCAGGGGGCAGTGTTCAGGTGCTGGTCACCCACGGCTCTCTTGGT[G/T]AGGGTATCTCTGAGTCTCTGCGCTCACTGAGTGAAACATCACCACAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32856
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057268 Nonsense 611 1942 12 32
ENSDART00000138562 None None 461 None 8
ENSDART00000144910 None None 256 None 4
Genomic Location (Zv9):
Chromosome 2 (position 11582338)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12007434
GRCz11 2 11791033
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGGATTTGCCAACTAATTATTTTATGTGGATCTTTTATTTAGGTAAGTA[T/A]CAGTCTCGAGCCTTGGCAGAGAGCATGCTGTCTACAAACGAGTTTCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25771
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057268 Nonsense 1079 1942 19 32
ENSDART00000138562 None None 461 None 8
ENSDART00000144910 Nonsense 187 256 3 4
Genomic Location (Zv9):
Chromosome 2 (position 11594349)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12019445
GRCz11 2 11803044
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCTGGAAGGACTTCCATGCATTGTCATCCTCACTGGAAAAGATCCTCTT[G/T]GAGAAACCTTCCCGAGGTACTTCATGCCAACTGTGTGAAATTATTCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14368
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057268 Essential Splice Site 1775 1942 29 32
ENSDART00000138562 Essential Splice Site 294 461 5 8
ENSDART00000144910 None None 256 None 4
Genomic Location (Zv9):
Chromosome 2 (position 11616329)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12041425
GRCz11 2 11825024
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATTCCCATCGGAGGACATAAAGACTTCCTCATCAAACCCAARCTCATGG[T/C]GAGCTTCRTAGTTGMCCTTCAGTAWGCTAGTTNNNNNNNNNNNNNNNTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1260
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057268 Nonsense 1915 1942 32 32
ENSDART00000138562 Nonsense 434 461 8 8
ENSDART00000144910 None None 256 None 4
Genomic Location (Zv9):
Chromosome 2 (position 11621594)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12046690
GRCz11 2 11830289
KASP Assay ID:
554-1175.1 (used for ordering genotyping assays)
KASP Sequence:
CGGAGCTCTCTGCGTCAGACTATTGTACGTCTGGAGCTGGAGGATGAGTG[G/A]CAATTTCGCCTGCGAGATGAGTTTCAAACGGCCAACTGCAGCGAGGACCG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461