Busch Lab

ZMP

si:dkey-201c13.4

Ensembl ID:
ENSDARG00000039181
ZFIN ID:
ZDB-GENE-060531-95
Description:
Novel protein similar to vertebrate transient receptor potential cation channel, subfamily M, member
Human Orthologue:
TRPM3
Human Description:
transient receptor potential cation channel, subfamily M, member 3 [Source:HGNC Symbol;Acc:17992]
Mouse Orthologue:
Trpm3
Mouse Description:
transient receptor potential cation channel, subfamily M, member 3 Gene [Source:MGI Symbol;Acc:MGI:2

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa20416 Nonsense Available for shipment Available now
sa14345 Essential Splice Site Available for shipment Available now
sa6977 Nonsense Mutation detected in F1 DNA Not yet available
sa18207 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20416
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088033 Nonsense 421 1662 9 24
ENSDART00000147188 Nonsense 421 1734 9 26
Genomic Location (Zv9):
Chromosome 5 (position 27671086)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25426384
GRCz11 5 26026537
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACAGAGTTGACATCGCCCGGAGCCAGATCTTCATTTACGGACAGCAGTG[G/A]CCTGTAGGCAATATCCACTCACACAAACCCAGTGCCTTGAAGTGACTGTA
Long Flanking Sequence:
AACAAAAAAATTAAAACATAAAAATAAATAAAGTAAAATTTAACATTTAAAATAAATAAATAAATAAATATCATTTAAGGTTCCAAAGCAAATCCAATTAGATCCACATGTTGGTAAACAAAGCAATTCTCTCATATAATGTAATATTAATTTTCAAAGGGTATTGTAAATAAATCATATAAACATTGATCTTTTCAAAAGCTAAAGCGATTATTACCTTGTTTTATTTGTTAGTAGTAATATACATATCAATGTTTTAACTAATTGCACATTGCTGAATGTCAGTCAAAGCCTACTGATTAGCTAGTTCAAATAAAATGAACAATTAACCCATTATCAAAATAATTAGTTGCACTAAATTGAACCAACTCCTAATTATGTGCCCTTTTCCTCATGTGTCCAGGAGCGAATGCATCAGCTCCAGATCAGCTAAGTCTGGCTTTGGCCTGGAACAGAGTTGACATCGCCCGGAGCCAGATCTTCATTTACGGACAGCAGTG[G/A]CCTGTAGGCAATATCCACTCACACAAACCCAGTGCCTTGAAGTGACTGTAATTCATTTAGATATAGAACTAAGATAGTGTATTGATCACAGAGGGGACAAGAGTCACTTCTGTGTACCTCTGATCTAATTAAACCACAGTGGATGCTAATGATAGCAAGCTGCATTAAAATTCATGAAACGGATTCACTGATGTGCGCCTGTGTGTGTTTTATTGTGCACCGGTACTGTGTGTTCTGCACCTGAGCACTGTATTGTTGTGTGGTCAGGTTGGCTCTCTGGAGCAGTCTATGCTGGACGCGCTGGTGCTGGACCGAGTGGACTTTGTAAAGCTGTTGATTGAGAACGGAGTGAGCATGCACCGTTTCCTGACACTCTCCAGACTTGAAGAGCTTTATAATACGGTAATATATCCACATTGGGTTTCAATATGAGTAGTTTTGAAAACTGTTTTTTTTTTTTTTTTATTGGGACTTTTGGATTCCACTGTACTTTACTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14345
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088033 Essential Splice Site 639 1662 14 24
ENSDART00000147188 Essential Splice Site 639 1734 14 26
Genomic Location (Zv9):
Chromosome 5 (position 27680879)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25436177
GRCz11 5 26036330
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGAACGRCATGGTCGATGACATTTCACAGGAGCTCAATCAAAACTCAAG[G/A]TAAGAATGTAAAGCTGTGTTATGACCTGCATGCTTTTCACCTGGATTYCC
Long Flanking Sequence:
TAAACATTTTAATAATTAAAATAAAAATTATAAAAATGTCTGTATTACATAGGCATTGTTATTAAGTAATAAATGCGTATTATTATTTAAAGACGTGACCAAGACCGAATTGTACTAAAATATTTATTCAAAACAAAGTGATTACATTTTATATATTTATTTTTCTCATTATAGTAATATATACCTTTTTGATTAATTCCATGATAGGATGACATGCCCATTAGACGAGGGCGTCAGAAGACTACGCGGAAGCGAGAGGAGGAAGTAGATATTGACCTGGATGACCCAGAAATCAATCATTTCCCTTTCCCATTCCATGAGCTGATGGTTTGGGCTGTGCTGATGAAACGGCAGAAGATGGCACTGTTCTTCTGGCAGCATGGAGAGGAGGCCATGGCTAAAGCGCTGGTGGCCTGCAAGCTCTGTAAGGCAATGGCTCACGAAGCTTCTGAGAACGACATGGTCGATGACATTTCACAGGAGCTCAATCAAAACTCAAG[G/A]TAAGAATGTAAAGCTGTGTTATGACCTGCATGCTTTTCACCTGGATTTCCTGTTTTCATTGCTGTTGGGGGAACACCATCTGTTATGTGCTAATCTGGCATCCCATCAAAGGCATCTTTAAAATTCATTAAAAGTCTTTAAAATTAGGTATCTTCAAAATTCTAAAGTCTACTTTTCTTTTAATAATGGTGTTTGAGATTAGTTTATCTTGCTTCCACAACTGAAACAATCTGTTTTTTGTGTGCATGTGCGCATACTGTTTGAATATGAATGTGTTTTTGGCACAGAAATATAGCATCTTTTTTCTTATCCATCAGGGAGTTTGGTCAGCTGGCTGTTGAGCTGCTCGATCAGTCCTATAAGCAGGATGAACAGATGGCTATGAAGCTGTTGACCTACGAGCTGAAGAACTGGAGTAATGCCACCTGTCTGCAGCTGGCAGTGGCTGCCAAGCACCGAGACTTCATCGCCCACACCTGTAGCCAGATGCTGCTCACAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3539
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088033 None None 1662 None 24
ENSDART00000147188 Essential Splice Site 845 1734 18 26
Genomic Location (Zv9):
Chromosome 5 (position 27692826)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25448124
GRCz11 5 26048277
KASP Assay ID:
2259-5826.1 (used for ordering genotyping assays)
KASP Sequence:
TCAGAAGGTTCATGACTGCCATCGGCTTATTCCAGTGGGTCGCAAAATAG[T/A]TTTACAASACCCCTATCGTCAAGTTCTGGTTTCACATGGTAATATCCATT
Long Flanking Sequence:
GATAATTTGGTAGAAAATGAGACAAAGCAAAGTAAGAAAAGCATTTACTGCATTGTGATTATTCAATTTCTGTAGCAGAATACTGTTTGCCTCCAATAAAACCTTCAAATAGTGATATCTTGTGAAACTGTATTCATATCGCAATATTTATTACAAAAAAAAATTTATATCAGATTTTTCCAATATTGTCCAACCCTAATATCAAATATATGTCCTAAAAATACCTTAAAAATACAAAAATATAAAATCAGTAATGAATATAAATTATAGAAATCATCAAATATGATTGTTTTTACTGTATTTTGATCTGTTTATTCTACTTAAGAAACATATTTTTTTTAAAAATTGGGTCATTGGGAAAACTATGAGTTTTATTGGGTATGGTTATTTTACCAAAATGAATCTAAACACAGTCATTTACTGTGTGATTGTGTTGAGTTTATATACTAATCAGAAGGTTCATGACTGCCATCGGCTTATTCCAGTGGGTCGCAAAATAG[T/A]TTTACAACACCCCTATCGTCAAGTTCTGGTTTCACATGGTAATATCCATTATTATGTACAAGTATGTGATGTACTGTGCGATGTTTAACATATCGAACATATATGAATGTCAACATATCTTTATATATTTAAAATGAGCTGAAACAACACAATTCTTGCGTTTTTGGGGTGGACAACTTTATTGTTTCAAGTTTAACTTTTGTGGTTTTGTGGTTAGTTCTAGATGACACTGAGAGATTGTGTTTTTACAGAGAGAGTGTAAATACATTTTTGCAGTGTAAATACCTTGATGGGCATAATAGATGACTTTTAAAAACATCAAGAAAATCATGGGCTTGATTGATAATGTTTTTACTATTATTATGTTTTTACTATTACTGTAATTACTCATTTATGGTTCATTACCAAAAATTTATCTAAAAAAATGCAATTGTTTATTTTTTCCCCAATTTCAGTTTAATGGAGAGAAGATTTTTTCACACATTTGTAAACATAATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6977
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088033 Nonsense 902 1662 19 24
ENSDART00000147188 Nonsense 972 1734 21 26
Genomic Location (Zv9):
Chromosome 5 (position 27697868)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25453166
GRCz11 5 26053319
KASP Assay ID:
554-4426.1 (used for ordering genotyping assays)
KASP Sequence:
CTGACCTCRTGGCCATCCTCATCTTCTCCATYGGGATGGTGCTTCGTCTG[C/T]AGGMCCCGCCGCTGATGAGCTACGGCAGGGTCATTTACTGCGTCAATATC
Long Flanking Sequence:
ATGCTGAAAACTATTACTCATCAAATTCCATAGAGGGGAAAATACCATTAAAGCCAGCATTTTTCTAAATATCTTCTTTTGTGTTTAGCTGGTGAGTAAATGTTGACAGAATTTAATGCTTGGGTGAATTATCCTGTTTTCAGAACATTTTTTTATTTTTTTTATCTTGAATAATCTTACTCTTTTTTTTTTTTTTCCCCATTACATATAGATCGAAATGTAAAAATCTTTCATAATGTTTCTTTTAATGATTCAGTTTTGTCAGTCGTTTTGTCATTATTTCTGTATGCCACTATTGTTTATTCATTCTGAAATAAATTGATCTTGCCACAAGAATAGCCATAGATGCTAATACACAAACAAACTCTCCTATGTTTCAGATCCTGATGTCCGAACCTGGGAAGCTGCTTCAGAAGGTGAAAGTGTGGTTACAGGAGTACTGGAACATCACTGACCTCATGGCCATCCTCATCTTCTCCATCGGGATGGTGCTTCGTCTG[C/T]AGGACCCGCCGCTGATGAGCTACGGCAGGGTCATTTACTGCGTCAATATCATTTATTGGTACATACGACTCCTCGACATCTTCGGAGTGAACAAATACCTGGGTCCATACGTCATGATGATCGGCAAGATGGTGAGGGATTGGTTTAATCATTAATGATAAATAGAGCAACTCTCAAATTCAGGTTGAAATGACTCTTGGTTTTTCTCTTTCCCCCCTTTTCCTCTTGATTCGGGGTGAGTGTAGATGATTGACATGATGTATTTTGTGATCATCATGTTGGTGGTGCTGATGAGTTTCGGTGTGGCGCGTCAGGCCATCCTTAATCCCAATGAAGACCCATCCTGGATGCTGGCACGCAATATCTTCTTCATGCCATACTGGATGATCTACGGAGAGGTGTTTGCTGACCAAATCGACCGTAAGGCTGGTTTATTGCATTGGTCACAAGGCGTTTTGGGTATACTAGGTTTCAGACTCAAGCCCAGCGCATCAGGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18207
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088033 Nonsense 924 1662 19 24
ENSDART00000147188 Nonsense 994 1734 21 26
Genomic Location (Zv9):
Chromosome 5 (position 27697934)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 25453232
GRCz11 5 26053385
KASP Assay ID:
2259-5827.1 (used for ordering genotyping assays)
KASP Sequence:
TGAGCTACGGCAGGGTCATTTACTGYGTCAATATCATTTATTGGTACATA[C/T]GACTCCTCGACATCTTCGGAGTGAAYAAATACCTGGGTCCRTAYGTCATG
Long Flanking Sequence:
AAATATCTTCTTTTGTGTTTAGCTGGTGAGTAAATGTTGACAGAATTTAATGCTTGGGTGAATTATCCTGTTTTCAGAACATTTTTTTATTTTTTTTATCTTGAATAATCTTACTCTTTTTTTTTTTTTTCCCCATTACATATAGATCGAAATGTAAAAATCTTTCATAATGTTTCTTTTAATGATTCAGTTTTGTCAGTCGTTTTGTCATTATTTCTGTATGCCACTATTGTTTATTCATTCTGAAATAAATTGATCTTGCCACAAGAATAGCCATAGATGCTAATACACAAACAAACTCTCCTATGTTTCAGATCCTGATGTCCGAACCTGGGAAGCTGCTTCAGAAGGTGAAAGTGTGGTTACAGGAGTACTGGAACATCACTGACCTCATGGCCATCCTCATCTTCTCCATCGGGATGGTGCTTCGTCTGCAGGACCCGCCGCTGATGAGCTACGGCAGGGTCATTTACTGCGTCAATATCATTTATTGGTACATA[C/T]GACTCCTCGACATCTTCGGAGTGAACAAATACCTGGGTCCATACGTCATGATGATCGGCAAGATGGTGAGGGATTGGTTTAATCATTAATGATAAATAGAGCAACTCTCAAATTCAGGTTGAAATGACTCTTGGTTTTTCTCTTTCCCCCCTTTTCCTCTTGATTCGGGGTGAGTGTAGATGATTGACATGATGTATTTTGTGATCATCATGTTGGTGGTGCTGATGAGTTTCGGTGTGGCGCGTCAGGCCATCCTTAATCCCAATGAAGACCCATCCTGGATGCTGGCACGCAATATCTTCTTCATGCCATACTGGATGATCTACGGAGAGGTGTTTGCTGACCAAATCGACCGTAAGGCTGGTTTATTGCATTGGTCACAAGGCGTTTTGGGTATACTAGGTTTCAGACTCAAGCCCAGCGCATCAGGTTTTATGTCTCATCATTACTGGTCAGATTGTATGCGCAAATGTGCTGAGCTGTTCTCTGATTGCATCAAC
Associated Phenotype:
Not determined