Busch Lab

ZMP

ca8

Ensembl ID:
ENSDARG00000039098
ZFIN ID:
ZDB-GENE-050417-26
Description:
carbonic anhydrase VIII [Source:RefSeq peptide;Acc:NP_001017571]
Human Orthologue:
CA8
Human Description:
carbonic anhydrase VIII [Source:HGNC Symbol;Acc:1382]
Mouse Orthologue:
Car8
Mouse Description:
carbonic anhydrase 8 Gene [Source:MGI Symbol;Acc:MGI:88253]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa8898 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8898
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057098 Nonsense 22 281 1 8
ENSDART00000140012 Nonsense 22 281 1 9
Genomic Location (Zv9):
Chromosome 2 (position 21651917)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22197332
GRCz11 2 21855394
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGAAGAGAGCGGTAATTACCCTGGAAAGGATGAGCTGGACTGGGGAYA[T/A]GAAGAAGGTAAGGACTTTGAGAGAATTAGTCCCTAAWTSTGCTCTCTGTG
Associated Phenotype:
Not determined