Busch Lab

ZMP

si:dkey-24p1.1

Ensembl ID:
ENSDARG00000039096
ZFIN ID:
ZDB-GENE-060503-631
Description:
B-cell receptor CD22 [Source:RefSeq peptide;Acc:NP_001091715]
Human Orthologue:
CD22
Human Description:
CD22 molecule [Source:HGNC Symbol;Acc:1643]
Mouse Orthologue:
Cd22
Mouse Description:
CD22 antigen Gene [Source:MGI Symbol;Acc:MGI:88322]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa39065 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa22709 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39065
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057095 Essential Splice Site 852 1043 None 16
ENSDART00000146866 Essential Splice Site 852 891 None 12
Genomic Location (Zv9):
Chromosome 15 (position 36804840)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38204844
GRCz11 15 38106429
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCTTAATAAGAGATCAACCATGTTCCATTTGTTATGTTTGAACACTC[A/T]GGGGTCTCGAAATAACACCCAGGAGAATTTGTCATTGGATGATCCAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22709
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057095 Nonsense 885 1043 12 16
ENSDART00000146866 Nonsense 885 891 12 12
Genomic Location (Zv9):
Chromosome 15 (position 36804739)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38204743
GRCz11 15 38106328
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGCACAGGTTAATCTATCATACCCAATCCAGCCTTCCCAAAATCCAACA[C/T]AAGGACAGGACCTTAATCCAAGGTATATTCAGCAAATCTGATCGAAACAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28518
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057095 Nonsense 918 1043 14 16
ENSDART00000146866 None None 891 None 12
Genomic Location (Zv9):
Chromosome 15 (position 36803660)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38203664
GRCz11 15 38105249
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATGTATTTTCTTATGAATATTTCTTTAAAGAAAAGACATTCGCCAAAA[C/T]AACAACAGAAGACTGGAAATATGGACAATACATCTATGAACTACGTCACT
Associated Phenotype:
Not determined