Busch Lab

ZMP

nkx2.3

Ensembl ID:
ENSDARG00000039095
ZFIN ID:
ZDB-GENE-990415-178
Description:
homeobox protein Nkx-2.3 [Source:RefSeq peptide;Acc:NP_571498]
Human Orthologue:
NKX2-3
Human Description:
NK2 transcription factor related, locus 3 (Drosophila) [Source:HGNC Symbol;Acc:7836]
Mouse Orthologue:
Nkx2-3
Mouse Description:
NK2 transcription factor related, locus 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97348]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3850
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057094 Nonsense 189 321 3 3
Genomic Location (Zv9):
Chromosome 13 (position 40757660)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 40284106
GRCz11 13 40409996
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAACATTTGGCGAGTACCCTAAAACTGACATCGACGCAGGTTAAAATTTG[G/A]TTCCAGAACCGCAGATACAAATGCAAGCGGCAGCGTCAAGACAAAACACT
Associated Phenotype:
Not determined