Busch Lab

ZMP

tyr

Ensembl ID:
ENSDARG00000039077
ZFIN IDs:
ZDB-GENE-991026-3, ZDB-GENE-991026-3
Description:
tyrosinase [Source:RefSeq peptide;Acc:NP_571088]
Human Orthologue:
TYR
Human Description:
tyrosinase (oculocutaneous albinism IA) [Source:HGNC Symbol;Acc:12442]
Mouse Orthologue:
Tyr
Mouse Description:
tyrosinase Gene [Source:MGI Symbol;Acc:MGI:98880]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3924
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057067 Nonsense 145 537 2 6
ENSDART00000122238 Nonsense 142 534 1 5
Genomic Location (Zv9):
Chromosome 15 (position 42573025)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 43776756
GRCz11 15 43799767
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTGTCCACTACCGAGAGGCAGAGGTTCATCTCGTACCTAAATCTGGCC[A/T]AAACCACCATAAGCCCCGATTATATGATCGTAACAGGAACGTACGCGCAG
Associated Phenotype:
Not determined