Busch Lab

ZMP

zgc:64090

Ensembl ID:
ENSDARG00000039069
ZFIN ID:
ZDB-GENE-040426-1365
Description:
UPF0492 protein C20orf94 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q7T2B3]
Human Orthologue:
C20orf94
Human Description:
chromosome 20 open reading frame 94 [Source:HGNC Symbol;Acc:16225]
Mouse Orthologue:
2210009G21Rik
Mouse Description:
RIKEN cDNA 2210009G21 gene Gene [Source:MGI Symbol;Acc:MGI:1921493]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa19065 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42248 Nonsense Mutation detected in F1 DNA Not yet available
sa698 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19065
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057052 Essential Splice Site 137 499 6 12
ENSDART00000144109 Essential Splice Site 128 490 4 10

The following transcripts of ENSDARG00000039069 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 35640459)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35293035
GRCz11 13 35418867
KASP Assay ID:
2260-6713.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTCCAGAGAATTCCGCACTTCCCAATGGAAATCTGAACCTGGATGTGG[T/A]AAGAACTGCTTATGTTATAAAATAATGTTTATAATCAGTGTCGGAGAAGC
Long Flanking Sequence:
GCCTTCGTTTTTCAAGCTAAATTTGGCCAAGTTTGGAGGAAATAAAGCGGAATACATCAAACAATGTGGTTTGTTTTAGTTATATCGAGTTACATATTTGAAACTTTATTGACTGAGGGGCAGCGGGGACATGAAGTCGCCCAATGTTAATGTTCAACTTTATGCCATTTTCTCAAAAACAACACAGCGTAGGGTTGCATAGTATTCAATTTTTCCCATGAAGAGGGCGTTGGGGTCAGTCTATCCTGCTGATGCTCCTGAACATTCATCGTCTGTGAGAATTTAATATGAATATCATACTTATTTCCCTCCCACCTTTCCATTTCAACCATTTTACCATTGTAAATTGACTGTATATACAGTAATAATGCCTTAAATGCTTTCCAACCCACTTTGTTTTTGACCTTCAGAGTTGCGTGTATTTCCCGAGCGTGTTGTAGTGTGTGCCAGTCCTCCAGAGAATTCCGCACTTCCCAATGGAAATCTGAACCTGGATGTGG[T/A]AAGAACTGCTTATGTTATAAAATAATGTTTATAATCAGTGTCGGAGAAGCTCCTTTTTAACTAGCTTGCCAAGCTACAGTCTACTTAAATAAATGTTGTTAAACTACAGTCAAGTGACCATCTTTAAAAAAAAAAAATGTATATATATTTGTCTGCCCAAAAGTATCTGTTTTGAAGCTAAACTGATTTTATTCTGTGGACAGTCTGTGGGCTTGACTTCTGAGGTGGTGACTAGTTATTCTCCAACTCTTTATATAATATATAAAGAATGTAAGAAAATGAAGTACATGTGTCTTTACTGTATAGTGTTTCCCAATGTTGAACCCATTCTCTGCAAATGCCATGAAGTGGGTTCTGGACTCATGTAGTTGATTCCTATGCGTTTTATTCTTCCCCTCTCTTATTATGGGGTGACAAATGAGTAGTTGAATGGGACTGATTGGTGAGGCTCTTTTTGCTCTATACTGTTCTGTGAGGTGGACCACTAAATTCCTTTGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42248
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057052 Nonsense 193 499 8 12
ENSDART00000144109 Nonsense 184 490 6 10

The following transcripts of ENSDARG00000039069 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 35616788)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35269364
GRCz11 13 35395196
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAGCCCCCACGATCGCAAGATAATCAAGAGTCCAAAACAGGACAATTT[C/T]AAGCAGACAATGCAGAGAAGGGCTCTAGATCTGTCCTTCAGAGGATGTAC
Long Flanking Sequence:
AAACATCCCATGGATTTGTTCCCATGGCTACACCAAATATCTCCAAGTTTATTCTTGTCAGTACAATGGACTTTTCTTTTGAGTCCATGAAAAAGAAAAAGAAAGAACTAATGTGCATCAGTTTTTGTCAGGTGTTGAGAGTTCTGAAACCTAGTGAGTTGTCTTCTTAGCATGCTTTCTTCTAAGACAGCATTCCACCTGAGTGTAAACCTAATAATGTAAAATGTAAACTTATTAATGAATGTGTTTATTATTTATTTAACAGAGTGAACAGAGTCAGTCAAAATACTTTTCTAACTCTGGTGAGACGGCAAATCCATTACCAATCTCCACAGCTACAAAAAGAGCTGTCCTTCAGAAGATGTAAGTATTGTTTTTATATAGACTGTGGTTGGCCTTCATCATCTTATTTAACATTTCCTGATTCTTCCAGTGCCAGAAAGACAAAAATCCAGCCCCCACGATCGCAAGATAATCAAGAGTCCAAAACAGGACAATTT[C/T]AAGCAGACAATGCAGAGAAGGGCTCTAGATCTGTCCTTCAGAGGATGTACGTAAGCAATGTTGAGATATACCTTTTGTTGATCTATTTCATTTTTATTTAAGATTTGATTATTCTTTTAGAACTAGACAGGAAAATGTTCAACAGTTCCAAGATGATCAAGAGTCCAAATCAGGCCAATTTCAAGCAGACAATGCAGAGAAGGCGTATAGATCTGTCTTTCAGAGAATGTACTGTACAAAAGCACTGTTGAGATATGACTTGTGCTGATCTATTTCATTTTTGTTTAAAATGTCCCTATTGTTTCAGAACCAGACAGGCAAACGTCCAACCCCAACAGTGCCAAGATGACCAAGTGTACAAATCAGGCCAATTTCAAGCAGACAAACAAGAAAAAGGCTCTGGAGATGTCCTTCAGAAGATGTAAGAGTTGTTCTGAAGTAGATTGGGGTCATCCGTTGTAATCTTCAATTTTCAATCTTCAATTTTCAATATTTCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa698
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057052 Nonsense 294 499 11 12
ENSDART00000144109 Nonsense 285 490 9 10

The following transcripts of ENSDARG00000039069 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 35614807)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35267383
GRCz11 13 35393215
KASP Assay ID:
554-0606.1 (used for ordering genotyping assays)
KASP Sequence:
ACATTTTCTATTTTTTTTNCAGAGCCAAAGAGACAAACACCCAACCTCCA[C/T]AATCCCAAGATGATCAAGAATTCAAATCAGGCCAATTTCCAGCAGGCGAA
Long Flanking Sequence:
TAGAGTCCAAATCAGGCCAATTTCATGCAGACCAAGCCGAGAAGAGGTCTAGAATGCACTGTTGTGATATAGCTTGTGGTCATCCATCTCATTAACATTTAACATTTCATTATTCTTTCAGAGGCAATAAGACAAACATCCAACCCCCACAAACACAAGATGATCAAGAGTACAAATTAGGCCAATTTAAAGCAGACCAATCAGAGAAGGGATCTAGATCTGTCCTTGAGAAGATGTAAGCACTGTTCTGATTTAGCTTGTTGTGATCTATCCTCAACTTCATTCATTTCCTTAATATTTTCAAGTGCCAGACAGGCAAACATCCAATCCCTACATTCCCAAGATGATCAAGAGTTCAAACGAGGCCAATTTCATAGAGACCAAGCAGAGAATAGGTCTAGAGCACACTGTTGGGATATAGCTGGTGGTCATCCATCTCATCTTTATTTAACATTTTCTATTTTTTTTTCAGAGCCAAAGAGACAAACACCCAACCTCCA[C/T]AATCCCAAGATGATCAAGAATTCAAATCAGGCCAATTTCCAGCAGGCGAATCAGAGAAGGGATCTAGATCTGTCCTTCAGGAGATGTAAGCGCTGTTCTGATTTAGCTTGTGGTCATCCATCTCTCATCTTCATTTAACATTTTCTTAATTTTTCCAGTGCCAGACAGGCAAACATCCAATCCCCACATTCCCAAGAAGATCAAGAGTTCAAATCAGGCCAATTTCAAGTAGCAGAGGAGTGTGTGGAAGCATGTCTCCCAGTCCCCATATCGGTCTCAAGCATTGAGTCATTGGTGGACGGGAAAGCATTGTCGTCATCTAAATTAAGTAACAATAAAGATGTCACCGAATCCTATCTTGACACCACCGGTCCAAGAAGACGCCCACGGGCCCCGAGTAGCTCAGGAGAGGACGCTGACCACCAAAAGACAAAAAGATTGCGACTTGGACAGTCTGCAGTGTCAAGCGATTCCAACAATCCCTCTTCCGGCTACGCCGC
Associated Phenotype:
Data not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3875
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057052 Nonsense 343 499 12 12
ENSDART00000144109 Nonsense 334 490 10 10

The following transcripts of ENSDARG00000039069 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 35614587)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35267163
GRCz11 13 35392995
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAAACATCCAATCCCCACATTCCCAAGAAGATCAAGAGTTCAAATCAGGC[C/T]AATTTCAAGTAGCAGAGGAGTGTGTGGAAGCATGTCTCYCAGTCCCCATA
Long Flanking Sequence:
TGTCCTTGAGAAGATGTAAGCACTGTTCTGATTTAGCTTGTTGTGATCTATCCTCAACTTCATTCATTTCCTTAATATTTTCAAGTGCCAGACAGGCAAACATCCAATCCCTACATTCCCAAGATGATCAAGAGTTCAAACGAGGCCAATTTCATAGAGACCAAGCAGAGAATAGGTCTAGAGCACACTGTTGGGATATAGCTGGTGGTCATCCATCTCATCTTTATTTAACATTTTCTATTTTTTTTTCAGAGCCAAAGAGACAAACACCCAACCTCCACAATCCCAAGATGATCAAGAATTCAAATCAGGCCAATTTCCAGCAGGCGAATCAGAGAAGGGATCTAGATCTGTCCTTCAGGAGATGTAAGCGCTGTTCTGATTTAGCTTGTGGTCATCCATCTCTCATCTTCATTTAACATTTTCTTAATTTTTCCAGTGCCAGACAGGCAAACATCCAATCCCCACATTCCCAAGAAGATCAAGAGTTCAAATCAGGC[C/T]AATTTCAAGTAGCAGAGGAGTGTGTGGAAGCATGTCTCCCAGTCCCCATATCGGTCTCAAGCATTGAGTCATTGGTGGACGGGAAAGCATTGTCGTCATCTAAATTAAGTAACAATAAAGATGTCACCGAATCCTATCTTGACACCACCGGTCCAAGAAGACGCCCACGGGCCCCGAGTAGCTCAGGAGAGGACGCTGACCACCAAAAGACAAAAAGATTGCGACTTGGACAGTCTGCAGTGTCAAGCGATTCCAACAATCCCTCTTCCGGCTACGCCGCACCAGACTCTGTTTGCAGTCCCCAGCCTGAGATTTCACAGACTAACCAAAGCGGGCTGGCCACAAGTCTAAGAGGCCTATCCGTCAAGCCCGTATCCTCTGGGTCCTCTATTAGTTCCAGACCGGCCGCCAGAGAGGAAAGGAAGGGGGGTGAACCCAGAACATCCCGATTACGCCGGCTCAAGAAGTCCTGAGGGGTGCAGTGGCGTACAACGAGAGCG
Associated Phenotype:
Not determined