Busch Lab

ZMP

stk25b

Ensembl ID:
ENSDARG00000039022
ZFIN ID:
ZDB-GENE-040426-2537
Description:
serine/threonine-protein kinase 25 [Source:RefSeq peptide;Acc:NP_998473]
Human Orthologue:
STK25
Human Description:
serine/threonine kinase 25 [Source:HGNC Symbol;Acc:11404]
Mouse Orthologue:
Stk25
Mouse Description:
serine/threonine kinase 25 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1891699]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa32903 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10029 Nonsense Available for shipment Available now
sa6836 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa852 Nonsense Available for shipment Available now
sa15243 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32903
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056963 Essential Splice Site 10 424 1 11
ENSDART00000146425 None None 341 None 9
Genomic Location (Zv9):
Chromosome 2 (position 22093972)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22980677
GRCz11 2 22636328
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGCTCTCATCCACTGAGATGGCGCACCTCCGCGACATGCAGAACCAGG[T/A]AAATCCGCAGCCCTGCCGAAGCTGCTCATCCTGCATCCACCCTGAGCTTT
Long Flanking Sequence:
ACATATTGACAAATGAGTTCACAAAGGTCTAACGTACAAGATAAATGGGAAAATAATTTGGATTTTAATTTCTGTCCAACTACAACTCCCACAATTCCTCATTCCTTGAATCATAATCTGCGCATGCGCTGTAGGTCCTATTATTTTGTTCTCCCGCAAGCAATAAATGAAGAGCCGCCCGAGCCTGCGTTGATCGTTATAAAACAATAACACGCGGAAAGCGGTTCGCTCGCACGCTGATGCTTTCATAAATGGAGTCACACGACACATAACTGTCATTCTCGCCAGGCTGCGGGGTCCGCCATCAGGGGATTGGAGGCCGAAAACGCGGCTGACGAACAGGACATGCAGAGGTGTTTTTGTATGTAAAAGCTAGCTAGCTAAGCAGGGGAACCAGAGTAAAACGTTGTAGAGTTTGTCAGCACCCCTTCTTTGGCAGAAAAGGCTACATCTGCTCTCATCCACTGAGATGGCGCACCTCCGCGACATGCAGAACCAGG[T/A]AAATCCGCAGCCCTGCCGAAGCTGCTCATCCTGCATCCACCCTGAGCTTTAATCTCGCTGTCTGTAGCATCACATTAACGTTTGGGGAGGCTGTCATGTCATGACATTTCTTTCTTTTAGTAATTAAAGCGGTCCTGACTTTATGTTGTCAAGATAACCGTTTAATGAAGCGTCTGCTTTTTGCTACGGCTTCAGTCCTGTTAAATTGTATAGATTAACGTGCTGTTTAGTGAAGCAGCTTTAGTTTGTGCAGATGTGATGTAGTCTGTGTTTTAAAGTGCCCACTGATTTATAACACAACATCTGTAATGGAGTTTTGTGTGTATTTGTATGCATGCATGCATGCATGCATGTGTGTGTGTGTGTGTGTGTATATGTGTTTGGTGTGTGTGTGTGTGTGTGTGTGTTTGTGTGTATCTGTGTGTGTATATATGTGTACTGTATATATGAGTGTTTGTTGTGTGTGTGTGTGTGTACGTAAATATGACAGGGCTTTTAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2083
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056963 Nonsense 151 424 5 11
ENSDART00000146425 Nonsense 62 341 3 9
Genomic Location (Zv9):
Chromosome 2 (position 22087122)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22973827
GRCz11 2 22629478
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTCACATTTGTGTCTTGTCGCCGCAGCTGCCAACGTGCTGCTGTCTGAG[C/T]AGGGTGACGTGAAGCTGGCAGACTTCGGGGTGGCAGGACAGCTCACAGAC
Long Flanking Sequence:
ACTATCCCTTTATGTAATGTAGGTATCTGTTTGTCTACAGTAAAACATTTTAGCTGAAACTGTGGTTATTGATAACATAACAGAAATTGAGAGTGAGAGTGTATCGCCAGAAGCCACTGGTATTCATTTTTCTTGCTTGTATACGCTTCCTTCCACTCTTCTTACTGTAGCACCACAGTTTCAGCTAAAAACATCCTTTAATGCTCTATTGAAGAAAGAAAGCTGGACTCAGAAACTACTAAATCTTCTTCCTTTCCTCCACCCTTAGTTGAAACCAGGCCCGCTAGAAGAGACGTACATCGCCACTATACTGAGGGAGATTCTGAAGGGACTGGAATACTTGCATTCGGAAAGGAAGATTCACCGTGATATCAAAGGTGTGATCACCCACACGTCTGCCTACTCCATCAGGCTTCATTTTCGGTTGATCAGTTGTATTCAGTGCCGATGATTCACATTTGTGTCTTGTCGCCGCAGCTGCCAACGTGCTGCTGTCTGAG[C/T]AGGGTGACGTGAAGCTGGCAGACTTCGGGGTGGCAGGACAGCTCACAGACACCCAGATCAAGAGAAACACTTTCGTGGGGACTCCTTTCTGGATGGCTCCTGAGGTCATCAAACAGTCTGCGTATGACTTTAAGGTGAGGATATCCGGATGAATGATTCTGAGCGTGTAGTAGAGCAAGCTGAATATTAATGAGGCTGCAGAGCTGTGAAAGCACACGTTCAGCAGAAAGGCTGGAGTGGTAAAACTGTTCATCAGTGCTTTTTTTTTTCTTAAAGTGGTAGGCATGGAAACCAATCAAAGTACGTTTTAGCATAGTAGCAGCTAATATTTTTTTTCTGGAATGTTTATGTAATGTTTATTTGTGGGAATTTTTCATGACATAAACAAAGATGGTTTGTTTTTTGACTGCAGGCAGACATTTGGTCCTTGGGAATTACAGCTATTGAACTGGCGAAGGGGGAACCCCCAAACTCGGACCTGCATCCAATGCGAGTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10029
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056963 Nonsense 189 424 5 11
ENSDART00000146425 Nonsense 100 341 3 9
Genomic Location (Zv9):
Chromosome 2 (position 22087008)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22973713
GRCz11 2 22629364
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAAACACTTTCGTGGGGAYTCCTTTCTGGATGGCTCCTGAGGTCATCAAA[C/T]AGTCTGCGTATGACTTTAAGGTGAGGATATCCGGATGAATGATTCTGAGC
Long Flanking Sequence:
CACTGGTATTCATTTTTCTTGCTTGTATACGCTTCCTTCCACTCTTCTTACTGTAGCACCACAGTTTCAGCTAAAAACATCCTTTAATGCTCTATTGAAGAAAGAAAGCTGGACTCAGAAACTACTAAATCTTCTTCCTTTCCTCCACCCTTAGTTGAAACCAGGCCCGCTAGAAGAGACGTACATCGCCACTATACTGAGGGAGATTCTGAAGGGACTGGAATACTTGCATTCGGAAAGGAAGATTCACCGTGATATCAAAGGTGTGATCACCCACACGTCTGCCTACTCCATCAGGCTTCATTTTCGGTTGATCAGTTGTATTCAGTGCCGATGATTCACATTTGTGTCTTGTCGCCGCAGCTGCCAACGTGCTGCTGTCTGAGCAGGGTGACGTGAAGCTGGCAGACTTCGGGGTGGCAGGACAGCTCACAGACACCCAGATCAAGAGAAACACTTTCGTGGGGACTCCTTTCTGGATGGCTCCTGAGGTCATCAAA[C/T]AGTCTGCGTATGACTTTAAGGTGAGGATATCCGGATGAATGATTCTGAGCGTGTAGTAGAGCAAGCTGAATATTAATGAGGCTGCAGAGCTGTGAAAGCACACGTTCAGCAGAAAGGCTGGAGTGGTAAAACTGTTCATCAGTGCTTTTTTTTTTCTTAAAGTGGTAGGCATGGAAACCAATCAAAGTACGTTTTAGCATAGTAGCAGCTAATATTTTTTTTCTGGAATGTTTATGTAATGTTTATTTGTGGGAATTTTTCATGACATAAACAAAGATGGTTTGTTTTTTGACTGCAGGCAGACATTTGGTCCTTGGGAATTACAGCTATTGAACTGGCGAAGGGGGAACCCCCAAACTCGGACCTGCATCCAATGCGAGTTTTGTTTCTCATTCCCAAAAACACTCCTCCAACGCTGGAGGGCTCCTACAGCAAACCCTTCAAAGAGTTCGTTGAGGCTTGCCTCAATAAAGACCCTCGCTTTGTGAGTATTTCAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6836
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056963 Essential Splice Site 196 424 6 11
ENSDART00000146425 Essential Splice Site 107 341 4 9
Genomic Location (Zv9):
Chromosome 2 (position 22086711)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22973416
GRCz11 2 22629067
KASP Assay ID:
554-4563.1 (used for ordering genotyping assays)
KASP Sequence:
TTGTGGGAATTTTTMATGACATAAACAAAGATGSTTTGTTTTTTGACTGC[A/T]GGCAGACATTTGGTCCTTGGGAAYTACAGCTATTGAACTGGYGAAGGGGG
Long Flanking Sequence:
GCTTCATTTTCGGTTGATCAGTTGTATTCAGTGCCGATGATTCACATTTGTGTCTTGTCGCCGCAGCTGCCAACGTGCTGCTGTCTGAGCAGGGTGACGTGAAGCTGGCAGACTTCGGGGTGGCAGGACAGCTCACAGACACCCAGATCAAGAGAAACACTTTCGTGGGGACTCCTTTCTGGATGGCTCCTGAGGTCATCAAACAGTCTGCGTATGACTTTAAGGTGAGGATATCCGGATGAATGATTCTGAGCGTGTAGTAGAGCAAGCTGAATATTAATGAGGCTGCAGAGCTGTGAAAGCACACGTTCAGCAGAAAGGCTGGAGTGGTAAAACTGTTCATCAGTGCTTTTTTTTTTCTTAAAGTGGTAGGCATGGAAACCAATCAAAGTACGTTTTAGCATAGTAGCAGCTAATATTTTTTTTCTGGAATGTTTATGTAATGTTTATTTGTGGGAATTTTTCATGACATAAACAAAGATGGTTTGTTTTTTGACTGC[A/T]GGCAGACATTTGGTCCTTGGGAATTACAGCTATTGAACTGGCGAAGGGGGAACCCCCAAACTCGGACCTGCATCCAATGCGAGTTTTGTTTCTCATTCCCAAAAACACTCCTCCAACGCTGGAGGGCTCCTACAGCAAACCCTTCAAAGAGTTCGTTGAGGCTTGCCTCAATAAAGACCCTCGCTTTGTGAGTATTTCAGTTATATGACAGGATTTCCCAATATGCAATACTGGCCAAATTTTTGATGAAGATTTGTTTTGCTAGCAAGATCTGGCTACAAGAGTGTGACATGCATTTAAAGGGATAGTTCACCCAAAAGTGTAAATTCCCTGTTAATTTTTTCATCCTCAGATCATCCGAGATGTAGTCTTTTTTCCAGTAAAACAACAAAGTTCTTGAGAAATCAAGATTTAAATTGAGAGGAAGGAGCCATTAATAGTGGGAAAGAAAAAGTGAATGGCTTTTTTTCTGCTTTTATTTAGACTTTTAATTCAGTGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25798
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056963 Nonsense 202 424 6 11
ENSDART00000146425 Nonsense 113 341 4 9
Genomic Location (Zv9):
Chromosome 2 (position 22086691)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22973396
GRCz11 2 22629047
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAACAAAGATGGTTTGTTTTTTGACTGCAGGCAGACATTTGGTCCTTG[G/T]GAATTACAGCTATTGAACTGGCGAAGGGGGAACCCCCAAACTCGGACCTG
Long Flanking Sequence:
GTTGTATTCAGTGCCGATGATTCACATTTGTGTCTTGTCGCCGCAGCTGCCAACGTGCTGCTGTCTGAGCAGGGTGACGTGAAGCTGGCAGACTTCGGGGTGGCAGGACAGCTCACAGACACCCAGATCAAGAGAAACACTTTCGTGGGGACTCCTTTCTGGATGGCTCCTGAGGTCATCAAACAGTCTGCGTATGACTTTAAGGTGAGGATATCCGGATGAATGATTCTGAGCGTGTAGTAGAGCAAGCTGAATATTAATGAGGCTGCAGAGCTGTGAAAGCACACGTTCAGCAGAAAGGCTGGAGTGGTAAAACTGTTCATCAGTGCTTTTTTTTTTCTTAAAGTGGTAGGCATGGAAACCAATCAAAGTACGTTTTAGCATAGTAGCAGCTAATATTTTTTTTCTGGAATGTTTATGTAATGTTTATTTGTGGGAATTTTTCATGACATAAACAAAGATGGTTTGTTTTTTGACTGCAGGCAGACATTTGGTCCTTG[G/T]GAATTACAGCTATTGAACTGGCGAAGGGGGAACCCCCAAACTCGGACCTGCATCCAATGCGAGTTTTGTTTCTCATTCCCAAAAACACTCCTCCAACGCTGGAGGGCTCCTACAGCAAACCCTTCAAAGAGTTCGTTGAGGCTTGCCTCAATAAAGACCCTCGCTTTGTGAGTATTTCAGTTATATGACAGGATTTCCCAATATGCAATACTGGCCAAATTTTTGATGAAGATTTGTTTTGCTAGCAAGATCTGGCTACAAGAGTGTGACATGCATTTAAAGGGATAGTTCACCCAAAAGTGTAAATTCCCTGTTAATTTTTTCATCCTCAGATCATCCGAGATGTAGTCTTTTTTCCAGTAAAACAACAAAGTTCTTGAGAAATCAAGATTTAAATTGAGAGGAAGGAGCCATTAATAGTGGGAAAGAAAAAGTGAATGGCTTTTTTTCTGCTTTTATTTAGACTTTTAATTCAGTGTTGATGTACTTGCAACTGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa852
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056963 Nonsense 239 424 6 11
ENSDART00000146425 Nonsense 150 341 4 9
Genomic Location (Zv9):
Chromosome 2 (position 22086578)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22973283
GRCz11 2 22628934
KASP Assay ID:
554-0755.1 (used for ordering genotyping assays)
KASP Sequence:
GTTYTGTTTCTCATTCCCAAAAACACTCCTCCAACGCTGGAGGGCTCCTA[C/A]AGCAAACCCTTCAAAGAGTTCGTTGAGGCTTGCCTCAATAAAGACCCTCG
Long Flanking Sequence:
CACAGACACCCAGATCAAGAGAAACACTTTCGTGGGGACTCCTTTCTGGATGGCTCCTGAGGTCATCAAACAGTCTGCGTATGACTTTAAGGTGAGGATATCCGGATGAATGATTCTGAGCGTGTAGTAGAGCAAGCTGAATATTAATGAGGCTGCAGAGCTGTGAAAGCACACGTTCAGCAGAAAGGCTGGAGTGGTAAAACTGTTCATCAGTGCTTTTTTTTTTCTTAAAGTGGTAGGCATGGAAACCAATCAAAGTACGTTTTAGCATAGTAGCAGCTAATATTTTTTTTCTGGAATGTTTATGTAATGTTTATTTGTGGGAATTTTTCATGACATAAACAAAGATGGTTTGTTTTTTGACTGCAGGCAGACATTTGGTCCTTGGGAATTACAGCTATTGAACTGGCGAAGGGGGAACCCCCAAACTCGGACCTGCATCCAATGCGAGTTTTGTTTCTCATTCCCAAAAACACTCCTCCAACGCTGGAGGGCTCCTA[C/A]AGCAAACCCTTCAAAGAGTTCGTTGAGGCTTGCCTCAATAAAGACCCTCGCTTTGTGAGTATTTCAGTTATATGACAGGATTTCCCAATATGCAATACTGGCCAAATTTTTGATGAAGATTTGTTTTGCTAGCAAGATCTGGCTACAAGAGTGTGACATGCATTTAAAGGGATAGTTCACCCAAAAGTGTAAATTCCCTGTTAATTTTTTCATCCTCAGATCATCCGAGATGTAGTCTTTTTTCCAGTAAAACAACAAAGTTCTTGAGAAATCAAGATTTAAATTGAGAGGAAGGAGCCATTAATAGTGGGAAAGAAAAAGTGAATGGCTTTTTTTCTGCTTTTATTTAGACTTTTAATTCAGTGTTGATGTACTTGCAACTGAAACTGAATATTGAGTATGGGATGGGGCTTTCTTTTGCTCTTTGTTTTCTCATATGTGGCAAAAGTCATCAAACTGACATCAGCAGTGAAGGACCACCACTCCAAAATGCTGAAGCA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15243
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056963 Nonsense 287 424 7 11
ENSDART00000146425 Nonsense 198 341 5 9
Genomic Location (Zv9):
Chromosome 2 (position 22084817)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22971522
GRCz11 2 22627173
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACACGATACACCAAGAAAACGTCTTATCTGACAGAGCTGATCGACCGATA[C/A]CGCCGATGGAAGTCYGAGGGCCAYGGAGATGAGTCTAGCTCTGATGATTC
Long Flanking Sequence:
TTAAAATTTATTTTTCTCTCTGACTTTAATGTTCTACTGCAGAAAAAATAAAAAATGTTGGAAAAAAAGCAGCAATCGACATTCATACTAGGAACAAAACATACTATACAGGTTAATGGCAGTCTTTTCCGCAGCATTCTACAAAATATCTTCCTTTGTGTTCAACAGAATAAGGAAACTGAAACAGGTTTGGAACAAGTGGCAGATGAGTAAATGATGACAGGTTTTGGGTGAAGTATCCCTTTAAGATCTAAAACATCAAATGACAATCTTTTGACCAGTAATGTGGCTAATTTTTAAATTACATGATTAAGCGATGGTTATAGTTAGACATCTTAATATTTCCTAAATGAGGCCGTCATGACGTTGTGTATTCTGAGCATGGCATTACTGTGTTCTTGTTTTATGCAGCGGCCCACAGCCAAGGAATTATTAAAGCACAAATTCATCACACGATACACCAAGAAAACGTCTTATCTGACAGAGCTGATCGACCGATA[C/A]CGCCGATGGAAGTCTGAGGGCCACGGAGATGAGTCTAGCTCTGATGATTCTGACATGTACGCCGTCCATCCATTGTAATGCATATACTGAATGATCAATAACCGCACTGTAATTCATCATGATGTATTATTCATTATTTATTACATGACAACTGGCCTTTTAATTTGAGCTCTGCTATATTGATCCTCATAAGTTCTAGCTATGAATTGAAACCGTTCTCTGTTTCTCCTCGTACTCATACAGGGATGGTGATGGTGATGATAGAGACCACTGTCCTGTGTGGACGTTCCCCACAGTTCGGCCCAGCTCCATGAACAAGCTCCAGAAGGGCTACACAAACACAGACTCAGAGGTAGGGCTGTGCAATTTATCGAAAATCCGATTTCGATTTTGGCTTCTAACGATTATGAAAAATCATTAATCAAGATAAATGATTATTCCATTATTTACCACCCCCTTTCCAGTTCTCCTCACTTGTTGCTCTTAAAAGCGCGAAAGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2041
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056963 Nonsense 316 424 8 11
ENSDART00000146425 Nonsense 233 341 6 9
Genomic Location (Zv9):
Chromosome 2 (position 22084543)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 22971248
GRCz11 2 22626899
KASP Assay ID:
554-2753.1 (used for ordering genotyping assays)
KASP Sequence:
TTCTCCTCRTACTCRTACAGGGATGGTGATGGTGATGATAGAGACCACTG[T/A]CCTGTGTGGACGTTCCCCACWGTYCGGCCCAGCTCCATGAACAAGCTCCA
Long Flanking Sequence:
TGACCAGTAATGTGGCTAATTTTTAAATTACATGATTAAGCGATGGTTATAGTTAGACATCTTAATATTTCCTAAATGAGGCCGTCATGACGTTGTGTATTCTGAGCATGGCATTACTGTGTTCTTGTTTTATGCAGCGGCCCACAGCCAAGGAATTATTAAAGCACAAATTCATCACACGATACACCAAGAAAACGTCTTATCTGACAGAGCTGATCGACCGATACCGCCGATGGAAGTCTGAGGGCCACGGAGATGAGTCTAGCTCTGATGATTCTGACATGTACGCCGTCCATCCATTGTAATGCATATACTGAATGATCAATAACCGCACTGTAATTCATCATGATGTATTATTCATTATTTATTACATGACAACTGGCCTTTTAATTTGAGCTCTGCTATATTGATCCTCATAAGTTCTAGCTATGAATTGAAACCGTTCTCTGTTTCTCCTCGTACTCATACAGGGATGGTGATGGTGATGATAGAGACCACTG[T/A]CCTGTGTGGACGTTCCCCACAGTTCGGCCCAGCTCCATGAACAAGCTCCAGAAGGGCTACACAAACACAGACTCAGAGGTAGGGCTGTGCAATTTATCGAAAATCCGATTTCGATTTTGGCTTCTAACGATTATGAAAAATCATTAATCAAGATAAATGATTATTCCATTATTTACCACCCCCTTTCCAGTTCTCCTCACTTGTTGCTCTTAAAAGCGCGAAAGACCGAATGCTTATGTGTGTGAGGCGCGCAGACAGCATGTGGTCTGCACTTGGTCTCATTCACACACTGTGACGAGCAGAGCACAGACATCTAAAGTCATCTTAACGTGAGCGCTTAAAGGTCAAATAGGTGTCAAAACGCAGTGTTTAGTGATTATTCTTATTACCTTCATTTTGCAATAAGGATCAAAAGACACGTGAAAGCAAAAACATTAAAGTAACAGCGCGCAATTCTTACTGCCGCCTTTTTTATCATTATTAATAAAACAACGAGAAAA
Associated Phenotype:
Not determined