Busch Lab

ZMP

fbxo5

Ensembl ID:
ENSDARG00000039020
ZFIN ID:
ZDB-GENE-030131-4027
Description:
F-box only protein 5 [Source:UniProtKB/Swiss-Prot;Acc:Q0V967]
Human Orthologue:
FBXO5
Human Description:
F-box protein 5 [Source:HGNC Symbol;Acc:13584]
Mouse Orthologue:
Fbxo5
Mouse Description:
F-box protein 5 Gene [Source:MGI Symbol;Acc:MGI:1914391]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa31965 Essential Splice Site Available for shipment Available now
sa8720 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38972 Nonsense Mutation detected in F1 DNA Not yet available
sa42299 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18636 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4535
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962 None None 384 1 6
ENSDART00000112924 Nonsense 45 182 1 5
ENSDART00000113450 Nonsense 27 346 1 7
Genomic Location (Zv9):
Chromosome 13 (position 47400224)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46652229
GRCz11 13 46942064
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTTGMGCTACCACTGCAATAGCGACAAGGGCGCGTTTATACGGACATA[T/A]GAGGACGACGTAAATATTSATTTTAACTTTTTAGAGGTAAGATAATAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31965
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962 Essential Splice Site None 384 None 6
ENSDART00000112924 Essential Splice Site 57 182 None 5
ENSDART00000113450 Essential Splice Site 39 346 None 7
Genomic Location (Zv9):
Chromosome 13 (position 47400262)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46652267
GRCz11 13 46942102
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATACGGACATATGAGGACGACGTAAATATTGATTTTAACTTTTTAGAGG[T/A]AAGATAATAACGTTTTCCTGTCATATCCACGTATTTCCGTTAAAATTAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8720
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962 Essential Splice Site 80 384 None 6
ENSDART00000112924 Essential Splice Site 146 182 None 5
ENSDART00000113450 Essential Splice Site 128 346 None 7
Genomic Location (Zv9):
Chromosome 13 (position 47403035)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46655040
GRCz11 13 46944875
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAACTACCAGAACAAGAGACATTCACTGGATATGGCATCAGATGATGAGG[T/C]GAAACGACAATCATTTTTAGCCGTGTGTACATGTKGGACGCRTGTTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38972
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962 Nonsense 101 384 3 6
ENSDART00000112924 Nonsense 167 182 3 5
ENSDART00000113450 Nonsense 149 346 3 7
Genomic Location (Zv9):
Chromosome 13 (position 47406081)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46658086
GRCz11 13 46947921
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGGCAGCGGCCTGACCGAAGACAGCGGTTACCTTTCCCTCCATAACAGC[C/T]AGGTGGACGTGGACGGACTGGACTCATTAGAGAGGAGTGAAGAGAATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42299
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962 Essential Splice Site 242 384 4 6
ENSDART00000112924 None None 182 None 5
ENSDART00000113450 Essential Splice Site 290 346 4 7
Genomic Location (Zv9):
Chromosome 13 (position 47408670)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46660675
GRCz11 13 46950510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATCAGTTGGCTCTTCAGCGCTGGAAAAAAGCAGAAAAAACACGCAGGG[T/C]AAGAATGGATGAACGTAACCCACACATTGATTCACTTCTGTGACACTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18636
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056962 Nonsense 253 384 5 6
ENSDART00000112924 None None 182 None 5
ENSDART00000113450 Nonsense 301 346 5 7
Genomic Location (Zv9):
Chromosome 13 (position 47410316)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 46662321
GRCz11 13 46952156
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTGTCTCTTGGTTTCAGGACTCGGGCCGGTCTATGGGATCTTTATCT[C/T]GAGACTTCACCTTGGACAGGGTGGTGTTCTCCTGCATGCAGACMGTTTCC
Associated Phenotype:
Not determined