Busch Lab

ZMP

FIG4 (1 of 2)

Ensembl ID:
ENSDARG00000039004
Description:
FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae) [Source:HGNC Symbol;Acc:16873
Human Orthologue:
FIG4
Human Description:
FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae) [Source:HGNC Symbol;Acc:16873
Mouse Orthologue:
Fig4
Mouse Description:
FIG4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2143585]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa29476 Nonsense Mutation detected in F1 DNA Not yet available
sa23824 Nonsense Available for shipment Available now
sa10829 Splice Site, Nonsense Available for shipment Available now
sa15712 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29476
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056934 Nonsense 13 403 2 11
Genomic Location (Zv9):
Chromosome 20 (position 53397865)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53378032
GRCz11 20 53183449
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTCTTCTGCTCTGTTGTTTGTGTGTGTTCAGTAAGCTGTGCAATGTGT[T/A]GGATCGGCTCAGTATGATCGCCGAAAGTGTGGTGAAGAGGACTGGCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23824
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056934 Nonsense 47 403 3 11
Genomic Location (Zv9):
Chromosome 20 (position 53404492)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53384659
GRCz11 20 53190076
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTGTTTGTATGAGCTGACCATATAAAATCTGTCTGTGTTGTTTAGGTG[G/A]GGAGATCTTGGAGGAACCGTCACACCTAATGGACGCTTACAGGTACACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10829
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056934 Splice Site, Nonsense 61 403 3 11
Genomic Location (Zv9):
Chromosome 20 (position 53404532)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53384699
GRCz11 20 53190116
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTTTAGGTGGGGAGATCTTGGAGGAACCGTCACACCTAATGGACGCTTA[C/T]AGGTACACCAAYACTACACTGTAYACTTTCCTGATGYTAAAATAGGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15712
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056934 Nonsense 349 403 10 11
Genomic Location (Zv9):
Chromosome 20 (position 53445392)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53425559
GRCz11 20 53230976
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCACAGARGAGCAGATCTCCAGCAGCTCTGAAGACGACAGTGAAGACGAT[C/T]GAGAAGACGACGCCAGCGCCTCGCAGAGATCCACACCKATCAGACTGACG
Associated Phenotype:
Not determined