Busch Lab

ZMP

DPYSL2 (1 of 2)

Ensembl ID:
ENSDARG00000038974
Description:
dihydropyrimidinase-like 2 [Source:HGNC Symbol;Acc:3014]
Human Orthologue:
DPYSL2
Human Description:
dihydropyrimidinase-like 2 [Source:HGNC Symbol;Acc:3014]
Mouse Orthologue:
Dpysl2
Mouse Description:
dihydropyrimidinase-like 2 Gene [Source:MGI Symbol;Acc:MGI:1349763]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa7118 Nonsense Mutation detected in F1 DNA Not yet available
sa34289 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa5769 Essential Splice Site F2 line generated Not yet available
sa2444 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa7118
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056885 Nonsense 168 573 5 14
Genomic Location (Zv9):
Chromosome 8 (position 5362588)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 5296750
GRCz11 8 5145487
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTTCTCTNTTTTTTTTTTTTTTTACAGGYGTCAACTYTTTTCTGGTCTA[T/A]CTGGCGTACAAAGACATCTTCCAGCTCAATGATTCCCAGGTAAACAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34289
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056885 Essential Splice Site 488 573 12 14
ENSDART00000056885 Essential Splice Site 488 573 12 14
ENSDART00000056885 Essential Splice Site 488 573 12 14
Genomic Location (Zv9):
Chromosome 8 (position 5342554)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 5315983
GRCz11 8 5126254
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAAACCCTTCCCAGACTACGTCTACAAGAGGATAAAGGCCCGCAGCAGG[G/T]TACATGCATGCACTCACACACACATCCAGACATTGTGGTTTTAAAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5769
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056885 Essential Splice Site 488 573 12 14
ENSDART00000056885 Essential Splice Site 488 573 12 14
ENSDART00000056885 Essential Splice Site 488 573 12 14
Genomic Location (Zv9):
Chromosome 8 (position 5342554)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 5315983
GRCz11 8 5126254
KASP Assay ID:
554-3062.1 (used for ordering genotyping assays)
KASP Sequence:
GCAAACCCTTCCCAGACTACGTCTACAAGAGGATAAAGGCCCGCAGCAGG[G/A]TACATGCATGCACTCACACACACATCCAGACATTGTGGTTTTAAAAAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2444
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056885 Essential Splice Site 488 573 12 14
ENSDART00000056885 Essential Splice Site 488 573 12 14
ENSDART00000056885 Essential Splice Site 488 573 12 14
Genomic Location (Zv9):
Chromosome 8 (position 5342554)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 5315983
GRCz11 8 5126254
KASP Assay ID:
554-3062.1 (used for ordering genotyping assays)
KASP Sequence:
GCAAACCCTTCCCAGACTACGTCTACAAGAGGATAAAGGCCCGCAGCAGG[G/A]TACATGCATGCACTCACACACACATCCAGACATTGTGGTTTTAAAAAGCA
Associated Phenotype:
Not determined