Busch Lab

ZMP

ccr6b

Ensembl ID:
ENSDARG00000038968
ZFIN ID:
ZDB-GENE-030131-8888
Human Orthologue:
CCR6
Human Description:
chemokine (C-C motif) receptor 6 [Source:HGNC Symbol;Acc:1607]
Mouse Orthologue:
Ccr6
Mouse Description:
chemokine (C-C motif) receptor 6 Gene [Source:MGI Symbol;Acc:MGI:1333797]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18007 Nonsense Available for shipment Available now
sa16404 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18007
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056884 Nonsense 288 359 1 1
ENSDART00000056884 Nonsense 288 359 1 1
Genomic Location (Zv9):
Chromosome 17 (position 52169418)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51554073
GRCz11 17 51643108
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGAGCAGGTCACGCTTATGACGCTTTCGGTYAGCCGGACCGCAGCGTA[T/A]CTGCACTGCTGCCTCAATCCCATCCTCTACGCCTTCATCGGGGTCAAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16404
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056884 Nonsense 288 359 1 1
ENSDART00000056884 Nonsense 288 359 1 1
Genomic Location (Zv9):
Chromosome 17 (position 52169418)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 51554073
GRCz11 17 51643108
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GAGGAGCAGGTCACGCTTATGACGCTTTCGGTYAGCCGGACCGCAGCGTA[T/A]CTGCACTGCTGCCTCAATCCCATCCTCTACGCCTTCATCGGGGTCAAATT
Associated Phenotype:
Not determined