Busch Lab

ZMP

im:6906849

Ensembl ID:
ENSDARG00000038917
ZFIN IDs:
ZDB-GENE-050506-110, ZDB-GENE-050506-110
Description:
Im:6906849 protein [Source:UniProtKB/TrEMBL;Acc:Q6DGC5]
Human Orthologue:
RAD50
Human Description:
RAD50 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:9816]
Mouse Orthologue:
Rad50
Mouse Description:
RAD50 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:109292]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa27506 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41557 Nonsense Mutation detected in F1 DNA Not yet available
sa34791 Nonsense Mutation detected in F1 DNA Not yet available
sa34790 Nonsense Available for shipment Available now
sa34789 Nonsense Mutation detected in F1 DNA Not yet available
sa34788 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa27506
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075927 None None 1312 None 25
ENSDART00000121721 Essential Splice Site None 409 1 11
Genomic Location (Zv9):
Chromosome 9 (position 56447729)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54861119
GRCz11 9 54361243
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGGAAGCACGTCAGTGCGCCGACGCGGGAAACACACGTCTTGGTTCATG[T/G]AAGTCCTGTAAGCTTGAGTTCAAGGGAAACTTGCTTCATTGTTTTTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41557
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075927 Nonsense 385 1312 8 25
ENSDART00000121721 Nonsense 385 409 9 11
Genomic Location (Zv9):
Chromosome 9 (position 56436301)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54849691
GRCz11 9 54349815
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACCCAGGTAAAGACTTTGGCGTCTTTCCTGGAGTTGGAGGGCTATGAT[C/T]GAACGCCACTTAGTGAGCGACAACTCCAAAGCTTTTACAGACAAATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34791
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075927 Nonsense 562 1312 11 25
ENSDART00000121721 None None 409 None 11
Genomic Location (Zv9):
Chromosome 9 (position 56431873)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54845263
GRCz11 9 54345387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGATGGACAAAGAGGAGCAGGTGAGGAAGATCAAGTCGAGACATAATGAA[G/T]AGCTGGTGTCTCTGCTGGGACACTTTCCAAACAAGAAAGAGCTGGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34790
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075927 Nonsense 606 1312 12 25
ENSDART00000121721 None None 409 None 11
Genomic Location (Zv9):
Chromosome 9 (position 56429077)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54842467
GRCz11 9 54342591
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATTAACAATTTGTTTTGTTTTTGTAGTAAAGAGCTTGCATCTGGAGAA[C/T]AGAAGAAGAGTCATTACACTGCAGAAATCAAACGAAAAGAAGAGCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34789
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075927 Nonsense 716 1312 13 25
ENSDART00000121721 None None 409 None 11
Genomic Location (Zv9):
Chromosome 9 (position 56426646)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54840036
GRCz11 9 54340160
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGACATGCAGTCCAAACTGCGGCTTGTCCCAGACAAGCTGAAGAATACG[G/T]AGCATGACTTGAAGAGGAAGGAGCGCAGACGTGATGAAATGATGACACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34788
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075927 Essential Splice Site 1130 1312 21 25
ENSDART00000121721 None None 409 None 11
Genomic Location (Zv9):
Chromosome 9 (position 56415911)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 54829301
GRCz11 9 54329425
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGAGCTGGCCAATAAAGACCTGGACATCTACTATAAAGCCCTAGACCA[G/A]TAAGCTGATTTTATTATCAGGGGGTTTCTAATGGGTAGAGTCAGGTAGCG
Associated Phenotype:
Not determined