Busch Lab

ZMP

pccb

Ensembl ID:
ENSDARG00000038910
ZFIN ID:
ZDB-GENE-040426-2467
Description:
propionyl-CoA carboxylase beta chain, mitochondrial [Source:RefSeq peptide;Acc:NP_998090]
Human Orthologue:
PCCB
Human Description:
propionyl CoA carboxylase, beta polypeptide [Source:HGNC Symbol;Acc:8654]
Mouse Orthologue:
Pccb
Mouse Description:
propionyl Coenzyme A carboxylase, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:1914154]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10683 Essential Splice Site Available for shipment Available now
sa19760 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10683
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099340 Essential Splice Site 197 558 5 16
ENSDART00000132549 Essential Splice Site 197 555 5 15
Genomic Location (Zv9):
Chromosome 2 (position 24887602)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25462379
GRCz11 2 25118013
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCATTCAGGAAGGTGTCGAGTCTCTTGCAGGATATGCTGAYATTTTCTTG[G/A]TAAGCTTGAATGGTTACAACCATAAATTTGATATATGCATTTTATRTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19760
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099340 Nonsense 421 558 12 16
ENSDART00000132549 Nonsense 421 555 12 15
Genomic Location (Zv9):
Chromosome 2 (position 24881440)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25456217
GRCz11 2 25111851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATAACTAAAGAATAATAAAATTGTTTCTACAGGCACAGCTCAAGAGTA[C/A]GGCGGCATCATCAGACATGGAGCCAAGCTGCTGTATGCTTTTGCAGAAGC
Associated Phenotype:
Not determined