Busch Lab

ZMP

hectd3

Ensembl ID:
ENSDARG00000038905
ZFIN ID:
ZDB-GENE-031118-179
Description:
HECT domain containing 3 [Source:RefSeq peptide;Acc:NP_001070627]
Human Orthologue:
HECTD3
Human Description:
HECT domain containing 3 [Source:HGNC Symbol;Acc:26117]
Mouse Orthologue:
Hectd3
Mouse Description:
HECT domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1923858]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa32927 Essential Splice Site, Missense Mutation detected in F1 DNA Not yet available
sa19769 Essential Splice Site Available for shipment Available now
sa25817 Nonsense Mutation detected in F1 DNA Not yet available
sa19770 Essential Splice Site Available for shipment Available now
sa8608 Nonsense Mutation detected in F1 DNA Not yet available
sa11205 Nonsense Available for shipment Available now
sa6012 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32927
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Essential Splice Site 201 854 3 21
ENSDART00000144837 Missense 201 854 3 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26629610)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26825806
GRCz11 2 26481440
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCAAACCCAAGGTGGCAGAGGCGGATGAGGCTGCTGTTCGAAAGTTGAG[G/T]CAAGTGAAAACTTTGACCGAAACATTTCAATCTGTAATAGAATGTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19769
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Essential Splice Site 287 854 5 21
ENSDART00000144837 Essential Splice Site 287 854 5 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26631425)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26827621
GRCz11 2 26483255
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGGACAGCACTGGATCCGTCTGCACATGAGGAGAGGCACTGTGGTCAA[G/A]TAAGGACGACTGGTCTGCTAGCGACTGTAATTAAAAAGGACTTTTTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25817
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Nonsense 369 854 8 21
ENSDART00000144837 Nonsense 369 854 8 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26634667)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26830863
GRCz11 2 26486497
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGAGGGAATCGACGTACGGATCAGGGGTCTAAAGATCAAATCGTCCTG[C/A]GAACGTGACTTGGGCCTGAATGCAGATGTGTTCCAATCTCCCAATCTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19770
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Essential Splice Site 408 854 9 21
ENSDART00000144837 Essential Splice Site 408 854 9 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26634874)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26831070
GRCz11 2 26486704
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCTTTTAGTGGCACTCAGTGTTTTTTTTTTATGTGTGTGCATGTCTGT[A/C]GGTTCATCACACTTCTGGACAGTCTATTGCCTCATATGGTGCCTGCATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8608
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Nonsense 433 854 9 21
ENSDART00000144837 Nonsense 433 854 9 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26634949)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26831145
GRCz11 2 26486779
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATTGCCTCATATGGTGCCTGCATGGGACTACAGTCTGGGAACATTCAAC[C/T]AGATCAAAGTYAGTACTCTTGTCTTGAGCAAATTTGTCCTATGSCATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11205
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Nonsense 494 854 10 21
ENSDART00000144837 Nonsense 494 854 10 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26636437)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26832633
GRCz11 2 26488267
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGCACCGGGACAATCCCACTCTRGATGTCACATGCAAAAATGCWGTTT[T/G]AACTCAGGTAGTCCACAAAATATGTACAGTAGATTTGTGNNNTTTTTTTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6012
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056795 Splice Site, Nonsense 752 854 18 21
ENSDART00000144837 Splice Site, Nonsense 752 854 18 21

The following transcripts of ENSDARG00000038905 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26642482)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26838678
GRCz11 2 26494312
KASP Assay ID:
554-3900.1 (used for ordering genotyping assays)
KASP Sequence:
TGTGGGAACSCTGRTATTAATATTAATGTTAATCAATCTTTCTATCAGCA[C/T]GATAYGAAGACTTGGAGCAAACAGATGTCAGAGTGCAGTACTTATGGGAA
Associated Phenotype:
Not determined