Busch Lab

ZMP

acadm

Ensembl ID:
ENSDARG00000038900
ZFIN ID:
ZDB-GENE-040426-1945
Description:
medium-chain specific acyl-CoA dehydrogenase, mitochondrial isoform 2 [Source:RefSeq peptide;Acc:NP
Human Orthologue:
ACADM
Human Description:
acyl-CoA dehydrogenase, C-4 to C-12 straight chain [Source:HGNC Symbol;Acc:89]
Mouse Orthologue:
Acadm
Mouse Description:
acyl-Coenzyme A dehydrogenase, medium chain Gene [Source:MGI Symbol;Acc:MGI:87867]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa6844 Nonsense Mutation detected in F1 DNA Not yet available
sa38335 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa6011 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa9731 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6844
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099233 Nonsense 85 424 4 12
ENSDART00000132125 Nonsense 87 426 4 12
ENSDART00000145262 Nonsense 83 248 4 9

The following transcripts of ENSDARG00000038900 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26623247)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26819443
GRCz11 2 26475077
KASP Assay ID:
554-4745.1 (used for ordering genotyping assays)
KASP Sequence:
TTTCAGATTTTTCTCTTTSCAGTATCCTTTCCCCCTTATTAAGAGAGCAT[G/A]GGAGCTGGGTCTAATGAACGGACATATTCCAGAGGACTGTGGTAAGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38335
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099233 Essential Splice Site 239 424 8 12
ENSDART00000132125 Essential Splice Site 241 426 8 12
ENSDART00000145262 Essential Splice Site 237 248 8 9

The following transcripts of ENSDARG00000038900 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26620816)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26817012
GRCz11 2 26472646
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGCTTCATTGTAGATGCTGATACCCCAGGAGTCCAGCCTGGCAGAAAG[G/A]TAAAGGCTGGTGACAGTCGTATTTGTGTCCCAAACTGCTAAAAACACTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6011
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099233 Essential Splice Site 239 424 8 12
ENSDART00000132125 Essential Splice Site 241 426 8 12
ENSDART00000145262 Essential Splice Site 237 248 8 9

The following transcripts of ENSDARG00000038900 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26620815)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26817011
GRCz11 2 26472645
KASP Assay ID:
554-3811.1 (used for ordering genotyping assays)
KASP Sequence:
AGGCTTCATTGTAGATGCTGATACCCCAGGAGTCCAGCCTGGCAGAAAGG[T/A]AAAGGCTGGTGACAGTCGTATTTGTGTCCCAAACTGCTAAAAACACTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9731
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099233 Essential Splice Site 286 424 9 12
ENSDART00000132125 Essential Splice Site 288 426 9 12
ENSDART00000145262 None None 248 None 9

The following transcripts of ENSDARG00000038900 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 26619208)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26815404
GRCz11 2 26471038
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTGGCTTTAAGATTGCCATGGGTGCATTTGACAAGACYAGACCACCAG[T/C]AAGTGTTATTGCTTATAAAGTGCAGATGTCTGCTTCATCCCGCKTCTCAT
Associated Phenotype:
Not determined