Busch Lab

ZMP

tmx3

Ensembl ID:
ENSDARG00000038894
ZFIN ID:
ZDB-GENE-050522-396
Description:
thioredoxin-related transmembrane protein 3 [Source:RefSeq peptide;Acc:NP_001018393]
Human Orthologue:
TMX3
Human Description:
thioredoxin-related transmembrane protein 3 [Source:HGNC Symbol;Acc:24718]
Mouse Orthologue:
Tmx3
Mouse Description:
thioredoxin-related transmembrane protein 3 Gene [Source:MGI Symbol;Acc:MGI:2442418]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa39843 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11147 Essential Splice Site Available for shipment Available now
sa19775 Essential Splice Site Available for shipment Available now
sa9830 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39843
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056782 None None 434 None 16
ENSDART00000137053 Essential Splice Site None 157 None 8
ENSDART00000145835 None None 437 1 16

The following transcripts of ENSDARG00000038894 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 27477307)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27673503
GRCz11 2 27329137
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGATTATGTCACTTGCCCAACACTGACTCTGCTGCTTGTAACATTTAA[A/G]GGATATTACGCGGTCAATGACAAGATTCTCAAGATGGCAAACATGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11147
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056782 Essential Splice Site 26 434 2 16
ENSDART00000137053 Essential Splice Site 29 157 3 8
ENSDART00000145835 Essential Splice Site 29 437 2 16

The following transcripts of ENSDARG00000038894 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 27477096)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27673292
GRCz11 2 27328926
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTCAGCCATTGCTTTGGTGTCAGGATACGTGGAGGAGCTCGATGACAA[G/A]TAAGTATTTTAYAATGTAAGCAAAAGGAATATAGTTTAATAGTTAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19775
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056782 Essential Splice Site 40 434 4 16
ENSDART00000137053 Essential Splice Site 43 157 5 8
ENSDART00000145835 Essential Splice Site 43 437 4 16

The following transcripts of ENSDARG00000038894 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 27475795)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27671991
GRCz11 2 27327625
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGATTTTGGTGTTATGCCATCTGTGAAATAATGATGTCTTATAATTGCA[G/A]TTTTATGCTCCATGGTGCGCGTACTGCCACACATTTGAGCCAGTATGGAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25820
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056782 Essential Splice Site 182 434 8 16
ENSDART00000137053 None None 157 None 8
ENSDART00000145835 Essential Splice Site 185 437 8 16

The following transcripts of ENSDARG00000038894 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 27472238)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27668434
GRCz11 2 27324068
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATTGTCCACACATATTTTTTTACTGCCTCTGAGGAAATCCTTCCAAAG[G/A]TAAGATGTTTCTGTAAAATAATCTGGAAAATATTCAGATTATCCTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9830
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056782 Essential Splice Site 275 434 12 16
ENSDART00000137053 None None 157 None 8
ENSDART00000145835 Essential Splice Site 278 437 12 16

The following transcripts of ENSDARG00000038894 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 27467618)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 27663814
GRCz11 2 27319448
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAACTCTGATGGAAAGGGTGTCTACAGAATACAGAGACCATTATAAAAG[G/A]TAAGAAGCACATTTATATGAACAAAAACAGCATGAAGAGTTATTTCTTAA
Associated Phenotype:
Not determined