Busch Lab

ZMP

LOC560023

Ensembl ID:
ENSDARG00000038891
Human Orthologues:
KLK14, KLK6, PRSS1, PRSS3, PRSS37, U66059.56
Human Descriptions:
Trypsin-X3 [Source:UniProtKB/Swiss-Prot;Acc:Q8IYP2]
kallikrein-related peptidase 14 [Source:HGNC Symbol;Acc:6362]
kallikrein-related peptidase 6 [Source:HGNC Symbol;Acc:6367]
protease, serine, 1 (trypsin 1) [Source:HGNC Symbol;Acc:9475]
protease, serine, 3 [Source:HGNC Symbol;Acc:9486]
protease, serine, 37 [Source:HGNC Symbol;Acc:29211]
Mouse Orthologues:
1700074P13Rik, 1810009J06Rik, 2210010C04Rik, AC161768.1, BC048599, Gm10334, Gm4744, Gm5771, Klk14, Klk6, Prss1, Prss2, Prss3, Prss37, Try10, Try4, Try5
Mouse Descriptions:
RIKEN cDNA 1700074P13 gene Gene [Source:MGI Symbol;Acc:MGI:1920731]
RIKEN cDNA 1810009J06 gene Gene [Source:MGI Symbol;Acc:MGI:1920876]
RIKEN cDNA 2210010C04 gene Gene [Source:MGI Symbol;Acc:MGI:1914623]
cDNA sequence BC048599 Gene [Source:MGI Symbol;Acc:MGI:3608323]
kallikrein related-peptidase 14 Gene [Source:MGI Symbol;Acc:MGI:2447564]
kallikrein related-peptidase 6 Gene [Source:MGI Symbol;Acc:MGI:1343166]
predicted gene 10334 Gene [Source:MGI Symbol;Acc:MGI:3641889]
predicted gene 4744 Pseudogene [Source:MGI Symbol;Acc:MGI:3643181]
predicted gene 5771 Gene [Source:MGI Symbol;Acc:MGI:3646222]
protease, serine, 1 (trypsin 1) Gene [Source:MGI Symbol;Acc:MGI:98839]
protease, serine, 2 Gene [Source:MGI Symbol;Acc:MGI:102759]
protease, serine, 3 Gene [Source:MGI Symbol;Acc:MGI:102758]
protease, serine, 37 Gene [Source:MGI Symbol;Acc:MGI:1914940]
trypsin 10 Gene [Source:MGI Symbol;Acc:MGI:3687012]
trypsin 4 Gene [Source:MGI Symbol;Acc:MGI:102757]
trypsin 5 Gene [Source:MGI Symbol;Acc:MGI:102756]
trypsinogen 4 [Source:RefSeq peptide;Acc:NP_001096130]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6749 Nonsense Mutation detected in F1 DNA Not yet available
sa44038 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa6749
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074385 Nonsense 104 250 3 5
Genomic Location (Zv9):
Chromosome 23 (position 37545522)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37344750
GRCz11 23 37447412
KASP Assay ID:
554-4776.1 (used for ordering genotyping assays)
KASP Sequence:
AGCAAGTKTGTACTGTGRCCAAAGTGTTCAGTCATGTTGCCTACAATCCG[A/T]AAACTTTTAACAATGACATCATGATTATTAAGGTAAGAAATCCACTAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44038
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074385 Essential Splice Site 114 250 3 5
Genomic Location (Zv9):
Chromosome 23 (position 37545555)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 37344783
GRCz11 23 37447445
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTTGCCTACAATCCGAAAACTTTTAACAATGACATCATGATTATTAAG[G/A]TAAGAAATCCACTAACAAATGCTCAAAACTACAGATGAATCCTTCTATTT
Associated Phenotype:
Not determined