Busch Lab

ZMP

ift80

Ensembl ID:
ENSDARG00000038879
ZFIN ID:
ZDB-GENE-041212-50
Description:
intraflagellar transport protein 80 homolog [Source:RefSeq peptide;Acc:NP_001008625]
Human Orthologues:
IFT80, RP11-432B6.3
Human Descriptions:
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9J614]
intraflagellar transport 80 homolog (Chlamydomonas) [Source:HGNC Symbol;Acc:29262]
Mouse Orthologue:
Ift80
Mouse Description:
intraflagellar transport 80 homolog (Chlamydomonas) Gene [Source:MGI Symbol;Acc:MGI:1915509]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa35783 Nonsense Mutation detected in F1 DNA Not yet available
sa35782 Nonsense Mutation detected in F1 DNA Not yet available
sa35781 Nonsense Available for shipment Available now
sa13176 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28387
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056763 Nonsense 2 777 2 20
ENSDART00000133943 Nonsense 2 777 2 20

The following transcripts of ENSDARG00000038879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 1529076)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1568961
GRCz11 15 1533870
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAAACAGGGACATTACCAGAGTAAAACACCAGAGGAGACGCTGAAGGATG[C/T]GATTGAAAACATCGTTGCTGAAGGAGCCCAAACATATCCTTTAAATTACT
Long Flanking Sequence:
TACGCTGTGAAAATAAATAAATATAAAAAATAAAAGTTAAATGTTTATTATGTTTTCATTCATTGCGCAGATCGCTCTCAATCTCGCGAGAAGTAGGATATCAGACCAGATAGAACTCGTTCTCGCGAGACGTGGGGCCAGAGTTGTTTTACCGTCAGTAATCTTTCTAGTATGCTGCTACTAAGAAATCTGTAACGACTAAAAGGAGATTTGGGATGTAATAAAGCGGCTAGAGTGTACTCAGAAAGTGCCCCTCATCACTATGGTCAGCATCTACATTATCCAATGCTTCAAATATGAGTTTGTCTGGAGCTCGTTAGCGCTGTAGTAACAACGCGTTTCCGTGGCAACGACGCCTTCAGCAGTCAGGTAAACACGGTACATGCTAATGCTAACGATACGCTGTTCTTGCTACTAGTCAATTTTCTGTTTTTTCATCTTTTCTTTTTATAAACAGGGACATTACCAGAGTAAAACACCAGAGGAGACGCTGAAGGATG[C/T]GATTGAAAACATCGTTGCTGAAGGAGCCCAAACATATCCTTTAAATTACTGCGTTATATTCATACCACTTTTCAACACACACATACATTTAGTATGAAATTGTTGATAACATATGTATCATGCCAGAGTGTCCAGGAATATTAGCTGATTTCCACTTTCGTGCAGTGATTATAATGGTGAATTGAGTGCTTTTAAAGAGATAGTTCAGCCTAAAATGAAAACTTACTGCCCCTTAGGTGGATCCAAACCTTCATTACTTACTTTGCTCTGTTGAACACAAATGAATATATTTTGAAGTATGTTAGAAACCTGTAACCATTATTATTGATGTAAAGTGGGTTTTATATTTGCACATTCCTTCAGTGACAACTTGTGAAAAGCTTTCCATAATATTTACCACGGTACTTTAAATATTCAGCCTGAAATCGCATGCAAGAATGACTTGAAAAGAACATTAGCGCTATTTAATTGACTGTGAACAATGTTCTACTTTAATAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35783
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056763 Nonsense 3 777 2 20
ENSDART00000133943 Nonsense 3 777 2 20

The following transcripts of ENSDARG00000038879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 1529072)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1568957
GRCz11 15 1533866
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGGGACATTACCAGAGTAAAACACCAGAGGAGACGCTGAAGGATGCGAT[T/A]GAAAACATCGTTGCTGAAGGAGCCCAAACATATCCTTTAAATTACTGCGT
Long Flanking Sequence:
CTGTGAAAATAAATAAATATAAAAAATAAAAGTTAAATGTTTATTATGTTTTCATTCATTGCGCAGATCGCTCTCAATCTCGCGAGAAGTAGGATATCAGACCAGATAGAACTCGTTCTCGCGAGACGTGGGGCCAGAGTTGTTTTACCGTCAGTAATCTTTCTAGTATGCTGCTACTAAGAAATCTGTAACGACTAAAAGGAGATTTGGGATGTAATAAAGCGGCTAGAGTGTACTCAGAAAGTGCCCCTCATCACTATGGTCAGCATCTACATTATCCAATGCTTCAAATATGAGTTTGTCTGGAGCTCGTTAGCGCTGTAGTAACAACGCGTTTCCGTGGCAACGACGCCTTCAGCAGTCAGGTAAACACGGTACATGCTAATGCTAACGATACGCTGTTCTTGCTACTAGTCAATTTTCTGTTTTTTCATCTTTTCTTTTTATAAACAGGGACATTACCAGAGTAAAACACCAGAGGAGACGCTGAAGGATGCGAT[T/A]GAAAACATCGTTGCTGAAGGAGCCCAAACATATCCTTTAAATTACTGCGTTATATTCATACCACTTTTCAACACACACATACATTTAGTATGAAATTGTTGATAACATATGTATCATGCCAGAGTGTCCAGGAATATTAGCTGATTTCCACTTTCGTGCAGTGATTATAATGGTGAATTGAGTGCTTTTAAAGAGATAGTTCAGCCTAAAATGAAAACTTACTGCCCCTTAGGTGGATCCAAACCTTCATTACTTACTTTGCTCTGTTGAACACAAATGAATATATTTTGAAGTATGTTAGAAACCTGTAACCATTATTATTGATGTAAAGTGGGTTTTATATTTGCACATTCCTTCAGTGACAACTTGTGAAAAGCTTTCCATAATATTTACCACGGTACTTTAAATATTCAGCCTGAAATCGCATGCAAGAATGACTTGAAAAGAACATTAGCGCTATTTAATTGACTGTGAACAATGTTCTACTTTAATAGTCATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35782
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056763 Nonsense 400 777 12 20
ENSDART00000133943 Nonsense 400 777 12 20

The following transcripts of ENSDARG00000038879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 1501705)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1541590
GRCz11 15 1506499
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGACACTTTCTGTTGGTGGATGGAGCGGAGGTGTATGTGTACTCGTAT[G/T]AGGGTCGTCTGATTTCATCCCCCAAGAGTCCCGGCATGAGAATGGACATC
Long Flanking Sequence:
TTAATAGCTAATTTCTAATCACTGATTTATTTTCATCATGCCATGATGACAGCACATAATGTTTGACTAGATCTTAATATTATTAGTACTAGTATTCAGCTTAAAGTGACATTTAAAGGCTTCACTAGGGTAATTGGGGTAAAGTTAGGGTAATTAGGCAAGTCATTGTATAACAGTGGTTTGTTCTGGAGACAATCCAAAACTAATATTGCTGAATAATATTGACCTTAAAATGACTTTAATAAATTAAAAACTGCTTTTATTCTAGCTGAAATAAAACAAATAAGACTTTTTCCAGAAGAACAAATATTAGAGGAAATACTGTGAACAATTCCTGAATCTGCTCAACATCATTTAGGGAAATAACTGAAAAAGTAAATAAATTCACAGGAGGATTAATAATTCTGACTTCAAATGTATGTTTGTTTTTTTCTATGTTTGTGGTCTGCGTCAGACACTTTCTGTTGGTGGATGGAGCGGAGGTGTATGTGTACTCGTAT[G/T]AGGGTCGTCTGATTTCATCCCCCAAGAGTCCCGGCATGAGAATGGACATCCTGAACTCTCAGTCCATCTCGCTGAGCAACGACACCATCGCTATACGGGACACCACTGATGAACGAGGTGCAGATTTACAGTACTGCATGCATGACTGGAGTGTATACTGAAGCTGAAACTTGCATGCAAAGCTGACTGTTGTAGTTAGCTACTCTATATATAGGGTTTATACCGTCCTGAATTTTTGGCTTTTTTTTTTTTTGTGGCAATCTTCAGGCCTGGAAATGTTTTGGAAAAATGAGTAAACTTGGGCTGCACAATCTACCGTTTCAGCATCAATATTGCAATGTGTGTGTCCGCAAAAGTCACATCACATGATATGTAATGTTAAACTGAATTATAGGTGATCAACAATTGAGAAAACATGAGATTTGAGATTTTATATGCTGTTATTGCAACATTTAACCATAACAGAGTGAAACTTTGTCATTTGCATGTGTTTTAAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35781
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056763 Nonsense 438 777 12 20
ENSDART00000133943 Nonsense 438 777 12 20

The following transcripts of ENSDARG00000038879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 1501591)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1541476
GRCz11 15 1506385
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATCTCGCTGAGCAACGACACCATCGCTATACGGGACACCACTGATGAA[C/T]GAGGTGCAGATTTACAGTACTGCATGCATGACTGGAGTGTATACTGAAGC
Long Flanking Sequence:
AAAGGCTTCACTAGGGTAATTGGGGTAAAGTTAGGGTAATTAGGCAAGTCATTGTATAACAGTGGTTTGTTCTGGAGACAATCCAAAACTAATATTGCTGAATAATATTGACCTTAAAATGACTTTAATAAATTAAAAACTGCTTTTATTCTAGCTGAAATAAAACAAATAAGACTTTTTCCAGAAGAACAAATATTAGAGGAAATACTGTGAACAATTCCTGAATCTGCTCAACATCATTTAGGGAAATAACTGAAAAAGTAAATAAATTCACAGGAGGATTAATAATTCTGACTTCAAATGTATGTTTGTTTTTTTCTATGTTTGTGGTCTGCGTCAGACACTTTCTGTTGGTGGATGGAGCGGAGGTGTATGTGTACTCGTATGAGGGTCGTCTGATTTCATCCCCCAAGAGTCCCGGCATGAGAATGGACATCCTGAACTCTCAGTCCATCTCGCTGAGCAACGACACCATCGCTATACGGGACACCACTGATGAA[C/T]GAGGTGCAGATTTACAGTACTGCATGCATGACTGGAGTGTATACTGAAGCTGAAACTTGCATGCAAAGCTGACTGTTGTAGTTAGCTACTCTATATATAGGGTTTATACCGTCCTGAATTTTTGGCTTTTTTTTTTTTTGTGGCAATCTTCAGGCCTGGAAATGTTTTGGAAAAATGAGTAAACTTGGGCTGCACAATCTACCGTTTCAGCATCAATATTGCAATGTGTGTGTCCGCAAAAGTCACATCACATGATATGTAATGTTAAACTGAATTATAGGTGATCAACAATTGAGAAAACATGAGATTTGAGATTTTATATGCTGTTATTGCAACATTTAACCATAACAGAGTGAAACTTTGTCATTTGCATGTGTTTTAAAAGCATTTGAAGATTATAAAACATTCATGCACAATAACTAAAAACATCTGAAACTTTAATGAAGAAAATCCTACTGATTTATTAATATAATGAAGACTATACAGTGTTATTTTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13176
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056763 Essential Splice Site 612 777 16 20
ENSDART00000133943 Essential Splice Site 612 777 16 20

The following transcripts of ENSDARG00000038879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 1494893)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1534778
GRCz11 15 1499687
KASP Assay ID:
2260-8033.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCAGCGCCCGCTGGGAGGATGCTCTCCGCATCTGCCGCTTCGCCAAGG[T/G]CAGCACAGCAYTCACTATAYCCTTGTTCAGTCACGACGTATGGAAAACAA
Long Flanking Sequence:
TTTGATAAAGCAGTTAGCTAAAGCAGTTTTTGGTAGAGGTACTCTGTAAATGGCTGTTGTCATGACGATCGTTGCAGACAGCGTGTGAACCTAGTTAGAGGGTTAGCTAAACTGTAGCCGCAGCTGAAATGAATGCTGTGAGGAAACTACTCCTTAAGAGAATGAATGCCATGATCATATGAATTTAAGAGTGACCGATTAAATCAGTTTTGATGTACAAGTAAATTTGAAGTAAAGTAAATATTCTAAAGGTCAGCGAGAGGCTATACCGTTTCAGTTAAGCAAAAGCTCAAACATGGGTAAATAAAAGAATCTTGTCTTCTGCAGTGAGTTCAGTCGTCCTCCTCAGATGGTGAGCTATGTGGGCAGTCAGGTGACCGTCAGACGTGTGGACGGCTCTCTGGTATGCACTGCGGTGTCACCGTACCCCACTTTACTGCATGAGTACACCAGCAGCGCCCGCTGGGAGGATGCTCTCCGCATCTGCCGCTTCGCCAAGG[T/G]CAGCACAGCATTCACTATACCCTTGTTCAGTCACGACGTATGGAAAACAACTCAATTGATAACACTGTCTCCTAACAAAACACGACAAGATTCCAGTGGCAAGCAAATCGTCTGTCCACATCAAACACGACATTTAAAACACCAACCACTGCACTCCCAATGCTTTTAATCAAATAATACCTACTAAACCTTGTTTAAGATGATTATTAGGCTACTGAGGGACTGATGTTGTTGGTTTGCACTCTGAATTTCATTTTCGAAGCATCTGCTAGTTATTTTACTGCCTATTTTTGCTGCTTTGAGTATGGCAATAAATGTCAGGTAAAATGTATTTAAACCAAGCGGCAACCTCCCGCTCTCCCTCAGGAAGCCAATATGGAAGTAACTAAAACTGCAATTCATCCGAAATCGTGGCCGCTCCTGCCTCCAAAACAGAGCAAATTTCAATTGAGCCCACTGTTAGAATGGCCAACTTTACAGCAGAATAAAGGTGTTTACAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3912
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056763 Essential Splice Site 612 777 16 20
ENSDART00000133943 Essential Splice Site 612 777 16 20

The following transcripts of ENSDARG00000038879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 1494893)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1534778
GRCz11 15 1499687
KASP Assay ID:
2260-8033.1 (used for ordering genotyping assays)
KASP Sequence:
CAGCAGCGCCCGCTGGGAGGATGCTCTCCGCATCTGCCGCTTCGCCAAGG[T/G]CAGCACAGCAYTCACTATACCCTTGTTCAGTCACGACGTATGGAAAACAA
Long Flanking Sequence:
TTTGATAAAGCAGTTAGCTAAAGCAGTTTTTGGTAGAGGTACTCTGTAAATGGCTGTTGTCATGACGATCGTTGCAGACAGCGTGTGAACCTAGTTAGAGGGTTAGCTAAACTGTAGCCGCAGCTGAAATGAATGCTGTGAGGAAACTACTCCTTAAGAGAATGAATGCCATGATCATATGAATTTAAGAGTGACCGATTAAATCAGTTTTGATGTACAAGTAAATTTGAAGTAAAGTAAATATTCTAAAGGTCAGCGAGAGGCTATACCGTTTCAGTTAAGCAAAAGCTCAAACATGGGTAAATAAAAGAATCTTGTCTTCTGCAGTGAGTTCAGTCGTCCTCCTCAGATGGTGAGCTATGTGGGCAGTCAGGTGACCGTCAGACGTGTGGACGGCTCTCTGGTATGCACTGCGGTGTCACCGTACCCCACTTTACTGCATGAGTACACCAGCAGCGCCCGCTGGGAGGATGCTCTCCGCATCTGCCGCTTCGCCAAGG[T/G]CAGCACAGCATTCACTATACCCTTGTTCAGTCACGACGTATGGAAAACAACTCAATTGATAACACTGTCTCCTAACAAAACACGACAAGATTCCAGTGGCAAGCAAATCGTCTGTCCACATCAAACACGACATTTAAAACACCAACCACTGCACTCCCAATGCTTTTAATCAAATAATACCTACTAAACCTTGTTTAAGATGATTATTAGGCTACTGAGGGACTGATGTTGTTGGTTTGCACTCTGAATTTCATTTTCGAAGCATCTGCTAGTTATTTTACTGCCTATTTTTGCTGCTTTGAGTATGGCAATAAATGTCAGGTAAAATGTATTTAAACCAAGCGGCAACCTCCCGCTCTCCCTCAGGAAGCCAATATGGAAGTAACTAAAACTGCAATTCATCCGAAATCGTGGCCGCTCCTGCCTCCAAAACAGAGCAAATTTCAATTGAGCCCACTGTTAGAATGGCCAACTTTACAGCAGAATAAAGGTGTTTACAG
Associated Phenotype:
Not determined