Busch Lab

ZMP

mrc1b

Ensembl ID:
ENSDARG00000038822
ZFIN ID:
ZDB-GENE-070705-13
Description:
Novel protein similar to human and mouse mannose receptor, C type 1 (MRC1) [Source:UniProtKB/TrEMBL;
Human Orthologues:
MRC1, MRC1L1
Human Descriptions:
mannose receptor, C type 1 [Source:HGNC Symbol;Acc:7228]
mannose receptor, C type 1-like 1 [Source:HGNC Symbol;Acc:23403]
Mouse Orthologue:
Mrc1
Mouse Description:
mannose receptor, C type 1 Gene [Source:MGI Symbol;Acc:MGI:97142]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa18640 Nonsense Available for shipment Available now
sa45105 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa16104 Nonsense Available for shipment Available now
sa32948 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18640
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056686 Nonsense 254 1426 4 31
ENSDART00000140523 None None 258 None 6
ENSDART00000148244 Nonsense 106 815 2 19
Genomic Location (Zv9):
Chromosome 2 (position 31252771)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31553831
GRCz11 2 31537049
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGCTGTCAGCAGCAAGGCGCTGAATTGCTGAGCATATCTGAACCTCAC[G/T]AACAATCCTTCATAGCARGTATGCGCAATTATCAAAATATTCTCTTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45105
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056686 Essential Splice Site 343 1426 6 31
ENSDART00000140523 None None 258 None 6
ENSDART00000148244 Essential Splice Site 188 815 4 19
Genomic Location (Zv9):
Chromosome 2 (position 31250534)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31551594
GRCz11 2 31534812
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGTGGATACATCTGCCAACGAGGTCATTCTGTTCCTACTGTTCCACCAG[G/A]TAGACTTCCCATCCTCTTTTCTAATCCATACAGCAGCAATTCACTGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16104
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056686 Nonsense 584 1426 11 31
ENSDART00000140523 None None 258 None 6
ENSDART00000148244 None 429 815 9 19
Genomic Location (Zv9):
Chromosome 2 (position 31245141)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31546201
GRCz11 2 31529419
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACCAACACTAAGCAAGTCCCATTCACTCACTTCAACTCTGGGATGCCA[G/T]GTATTATGTTAAAAACWTTATGACAATAGATTGAAGAGRATTCTTATAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8087
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056686 Nonsense 606 1426 12 31
ENSDART00000140523 None None 258 None 6
ENSDART00000148244 Nonsense 451 815 10 19
Genomic Location (Zv9):
Chromosome 2 (position 31244965)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31546025
GRCz11 2 31529243
KASP Assay ID:
2259-2194.1 (used for ordering genotyping assays)
KASP Sequence:
GTTGCAATGACGACTGGAATAGTTGCTGGGCTTTGGGATGTGCTTAGCTG[T/A]TCAAATAAGGAAAAATACATCTGCAAGCAAAGAGCTGATGCTCTAGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32948
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056686 Essential Splice Site 766 1426 15 31
ENSDART00000140523 None None 258 None 6
ENSDART00000148244 Essential Splice Site 611 815 13 19
Genomic Location (Zv9):
Chromosome 2 (position 31242775)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31543835
GRCz11 2 31527053
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACGTGAACTGTAAAGACAAGAAGGACTGGTACTGTCAGATCCACAAAG[G/A]TAAATGGAGAAAGGTCTCAGTCTTCAAACTAAATTTTTTTCATTTTTGTT
Associated Phenotype:
Not determined